Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA035639 Similarity: 0.983 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA035639
Gene: ENY2
MFE: -30.696
ENS: 0.991
Length: 87.
Predicted Ligands:
glycine - 12/20
GMP - 2/20
fluoride - 2/20
 RS: URS0000C3D49A_1641393
MFE: -19.485
Ligand: glycine
Species: Clostridiales bacterium 38_11 Glycine riboswitch
 RS: URS0000C453FA_1262449
MFE: -16.626
Ligand: glycine
Species: Clostridium pasteurianum DSM 525 = ATCC 6013 Glycine riboswitch
 RS: URS0000D67E77_12908
MFE: -27.382
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA035639 URS0000C3D49A_1641393 URS0000C453FA_1262449 URS0000D67E77_12908
Length 87. 87. 87. 87.
Similarity - 0.983 0.982 0.981
Ensemble Norm 0.991 - - -
MFE -30.696 -19.485 -16.626 -27.382
Ligands - glycine glycine GMP
Gene ENY2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.001 8.003 2.
Length SE - 0. 0. 0.
Lev Distance - 23. 22. 25.
UBS 5. 5. 6. 6.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 1.
ILR 3. 3. 2. 3.
H 1. 1. 1. 1.
BL 1. 1. 3. 2.
BR 1. 1. 2. 1.
UN 0.126 0.161 0.184 0.138

Sequences

Field Description
UTR seq + 25 guaacgguccucagcgcaagggucauuucgucgcugggaagggacggcccucgcccgcggugATGAACAAAGATGCGCAGATGAGAG
UTR dot + 25 ………(((((((((……..((((((((((((.((((….))))…)).))))))))))……)))))…))))..
RS 1 seq GGACAAACCUCUGGAGAGACUCUAUGUGAGCACCGAAGGGGAAAACCGAAAGGUGAAACUCUCAGGUAAAAGGACAGAGGCAGAUUA
RS 1 dot …….((((((………(((.((((((((….((…..))….))))…..)))).)))……))))))…….
RS 2 seq AGAUGAAACCUUGGAGAGACUCUUGAUGAGCACCGAAGGAGAAAGUCGUACGGCAAAACUCUCAGGUAAAAGGACAGGGAAAAGGAA
RS 2 dot ……..(((((……..(((((.(((..(((.(.((…..)).).)))…..))))))))……..)))))……..
RS 3 seq AGUUCCGAGGGAGACGUCUGAGCGCAUCGCCGACCACACGGUCACCAUGUGGCGAGCGCGAGUCAAUGGUGAGACCGGCCCUGAUCA
RS 3 dot …….((((….((((.(((((.(((((((((….))))…….)))))))))……….).))))…))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table