Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA035640 Similarity: 0.983 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA035640
Gene: ENY2_0
MFE: -23.298
ENS: 0.945
Length: 97.
Predicted Ligands:
glycine - 18/20
Mg2+ - 1/20
homocysteine - 1/20
 RS: URS0000D9056C_1893
MFE: -32.346
Ligand: glycine
Species: Streptomyces atratus Glycine riboswitch
 RS: URS0000C06432_1588020
MFE: -34.288
Ligand: glycine
Species: Arthrobacter sp. Hiyo1 Glycine riboswitch
 RS: URS0000C46071_1609095
MFE: -34.796
Ligand: glycine
Species: Streptomyces sp. NRRL F-4489 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA035640 URS0000D9056C_1893 URS0000C06432_1588020 URS0000C46071_1609095
Length 97. 97. 98. 97.
Similarity - 0.983 0.982 0.981
Ensemble Norm 0.945 - - -
MFE -23.298 -32.346 -34.288 -34.796
Ligands - glycine glycine glycine
Gene ENY2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 2. 7.002
Length SE - 0. 1. 0.
Lev Distance - 22. 23. 23.
UBS 6. 5. 6. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 3. 2. 2. 2.
H 1. 1. 1. 1.
BL 2. 2. 3. 1.
BR 2. 2. 2. 1.
UN 0.062 0.103 0.082 0.103

Sequences

Field Description
UTR seq + 25 ucugugugcuuaggugcccgagcuacugagggucuaaguccgggcagccgaagagugugguagguuagcaagATGAACAAAGATGCGCAGATGAGAG
UTR dot + 25 (((((((((((.((((((((.((((((…)))…))).)))))).))…))))……………………….)))))))……
RS 1 seq UGACCCCGUGCGGGAGAGUCCUCCGGAGCUGAUCCGAAGGCGCCGAAGGAGCAAAUCCUCCCCGGAAUCUCUCAGGCCCCCGUACCGCACGGACGAG
RS 1 dot …..(((((((((((((((((.(((.(((……..))).))).))))………………)))))………..))))))))…..
RS 2 seq UGAUCUGCGGCGGGAGAGUCCUGCAGGCAUGUGAUGCAGGCGCCGUAGGAGCAAAUCCUCCCCAGGAAUCUCUCAGGCCCACGCACCGCCGCGGCAAG
RS 2 dot ….((((((((((((((((((((.(((.(.((…)).).)))))))))……………….)))))………..)))))))))….
RS 3 seq CGACCCCAUGCGGGAGAGUCCUUUGCCGCUCGCGGCAGGGCGCCGAAGGAGCAAAUCCUCCCCGGAAUCUCUCAGGCACACGUACCGCAUGGACGAG
RS 3 dot …..((((((((((((((((((((.(((((……))))).)))))))………………)))))………..))))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table