Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA035642 Similarity: 0.958 Similarity: 0.950 Similarity: 0.949
UTR: 5HSAA035642
Gene: ENY2_1
MFE: -46.745
ENS: 0.916
Length: 171.
Predicted Ligands:
cobalamin - 12/20
SAM - 2/20
Mg2+ - 2/20
 RS: URS00007CED20_408184
MFE: -67.
Ligand: cobalamin
Species: Mesorhizobium sp. ORS 3359 Cobalamin
 RS: URS0002314AF0_1302244
MFE: -53.135
Ligand: cobalamin
Species: Propionibacterium acnes JCM 18920 Cobalamin riboswitch
 RS: URS0000C268B9_68262
MFE: -69.333
Ligand: SAM
Species: Streptomyces regalis SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA035642 URS00007CED20_408184 URS0002314AF0_1302244 URS0000C268B9_68262
Length 171. 170. 169. 170.
Similarity - 0.958 0.950 0.949
Ensemble Norm 0.916 - - -
MFE -46.745 -67. -53.135 -69.333
Ligands - cobalamin cobalamin SAM
Gene ENY2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12. 7.002 2.002
Length SE - 1. 4. 1.
Lev Distance - 48. 57. 66.
UBS 13. 13. 13. 14.
BS 0. 0. 0. 0.
ILL 4. 2. 3. 3.
ILR 6. 4. 4. 6.
H 3. 3. 3. 3.
BL 4. 6. 5. 4.
BR 3. 3. 4. 3.
UN 0.070 0.071 0.112 0.112

Sequences

Field Description
UTR seq + 25 gagcuacugagggucuaaguccgggcagccgaagagugugguagguaacgguccucagcgcaagggucauuucgucgcugggaagggacggcccucgcccgcggugaugguuagcaagaugaacaaagaugcgcagaugagagcagATGAACAAAGATGCGCAGATGAGAG
UTR dot + 25 ..((..(((((((…….(((.((.((((…….))))..))..)))))))))).))…(.((((((((((((((((.((((….))))…)).)))))))))…….))))).)..(..((((((..(…………….)..))))))..)…..
RS 1 seq GCCGCUGCCUGGUGCCCGCGACGCGGGAGAAUCGGGAACACGGUUUCAUUCCGUGGCGUGCCCAACGCUGUGAGGGGGAUCGCGCCGGCAAAUGCCACUGUCGAUGACGGGAAGGCGCCGGAGCGGGACGAUCCCGAGCCAGAAGACCGGCCCGGCAGACAUGGUUUUCC
RS 1 dot ..(((.((.(((.((.(((..(((((((((((((……))))))..)))))))))).)))))..)).)))…((((((((.(((((….(((.(((((…)))))…)))))))).))…..))))))……((((((((…………)))))))).
RS 2 seq GUGAUGUCUCGUCUCAGCUAUGCUCGAUAUGCGAUCGAGCGAUGAGCAAUCCGGUGAGAUUCCGGAGCGGUCCCGCCACUGUGAGACACCCCCAUGCGGUGCAGCCAGACGCUCUGCCCGAUUCCUGCCGAACAGACCGUCAGGCGAGGGUACCUGAGGAGAACCACAU
RS 2 dot ..(((..((((((……..(((((((…..)))))))))))))..)))(((((.((.((((((((.(((..(((((((((.(…….).)))))))..))..)))))))))…)).)).)))))…….(.(((((……..))))).)……….
RS 3 seq AGCUCAUCCAGAGGGGCAGAGGGAAACGGCCCGAUGAAGCCCCGGCAACCCUCCAGUCGGCUCUCGUAGCGAUCACUGCCGUAACACCGCUGAUCGUCUCCGCGAGGCUCCCGGCUAGGGAAGGUGCCAAAUCCGUCUCACGGCGAGAUGCGUCGUGAGGAAGAUGAGGA
RS 3 dot …………((((((..(((……)))..)…)))))(((.(((.(((((((((.((((((((((((((..((.((…)).)))))))).))..))))))…))))))..))).))))))..(((..((((((((((…..))))))))))..)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table