Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA035737 Similarity: 0.971 Similarity: 0.970 Similarity: 0.969
UTR: 5HSAA035737
Gene: EPB41L3
MFE: -36.003
ENS: 0.997
Length: 111.
Predicted Ligands:
TPP - 14/20
methionine - 2/20
guanidine - 1/20
 RS: URS0000C8035A_1795868
MFE: -41.356
Ligand: guanidine
Species: Alcanivorax sp. Nap_24 Guanidine-I riboswitch
 RS: URS0000D7F5F3_1385519
MFE: -47.317
Ligand: methionine
Species: Knoellia aerolata DSM 18566 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000C5C415_1736413
MFE: -36.914
Ligand: TPP
Species: Nocardioides sp. Soil797 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA035737 URS0000C8035A_1795868 URS0000D7F5F3_1385519 URS0000C5C415_1736413
Length 111. 111. 111. 111.
Similarity - 0.971 0.970 0.969
Ensemble Norm 0.997 - - -
MFE -36.003 -41.356 -47.317 -36.914
Ligands - guanidine methionine TPP
Gene EPB41L3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 13. 16.001
Length SE - 0. 0. 0.
Lev Distance - 37. 34. 34.
UBS 10. 10. 10. 10.
BS 0. 0. 0. 0.
ILL 2. 2. 4. 5.
ILR 3. 3. 3. 2.
H 3. 2. 2. 2.
BL 5. 3. 3. 3.
BR 3. 3. 1. 4.
UN 0.045 0.045 0.063 0.081

Sequences

Field Description
UTR seq + 25 cgcaccgccgccgaggacgcgcgcccgagccuaguccccacgccgcggcgcgcccgggcucccugcugaucccagaacaaucaaccATGACGACCGAATCTGGATCAGACT
UTR dot + 25 (((.((((.((.(.((((..((……))…)))).)..)).)))).)))..((((…))))(((((.(((((….((………))…..))))))))))…
RS 1 seq UCAAUGGAUCGCUAGGGUUCCGGUCGGCAACGCCGAUGCCUGGUCCGAGAGCGGUCGACCUUCGCCCGGCGCGCCGGGGAGGUUACACGGCGGGACAAAAGCCCGGGAGGA
RS 1 dot ….(.(((((((.(((..((((((((…..))))…)))))))…))))))).)(((…((((((.((((((……..).))))).)……..)))))))).
RS 2 seq GGUCAUGAGUCCCAGCGACAAGCCCCGGCUUGCUGGGCGGCAACCCUCCUCGCGGUGGGGUGCCCCGGGUGAAGACACGGUCCGUCGGCACCCGACGGGCAAGCGCGAUCC
RS 2 dot (((..((.(.(((((((…(((….)))))))))))..)))))….(((((.(….(((((((((((..(((…….)))..))))))..)))))).)))))…
RS 3 seq GGCAUCCACCACAGGAGUCCCGAGGCAGGGGCUGAGAGGGAGCUGAAGCCGCUCCGACUGUUGAACCUGAUCCGGGUCAUGCCGGCGAAGGAAGCGAGGAGCUGUCCCUGU
RS 3 dot (((.(((..(.(…((((((……))))))).)..))))))…((.(((((…((((…(((…((((……))))…))).)))).))))).))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table