Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA035757 Similarity: 0.983 Similarity: 0.983 Similarity: 0.981
UTR: 5HSAA035757
Gene: EPB41L3_0
MFE: -12.909
ENS: 0.992
Length: 82.
Predicted Ligands:
zmp-ztp - 7/20
cyclic-di-GMP - 7/20
fluoride - 3/20
 RS: URS0002326795_1805286
MFE: -19.766
Ligand: zmp-ztp
Species: Candidatus Omnitrophica bacterium CG1_02_43_210 ZMP/ZTP riboswitch
 RS: URS00021E381D_553981
MFE: -18.354
Ligand: fluoride
Species: Chromatiaceae bacterium RW crcB
 RS: URS0000C6CC3E_1734396
MFE: -12.724
Ligand: cyclic-di-GMP
Species: Desulfosporosinus sp. BRH_c37 Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA035757 URS0002326795_1805286 URS00021E381D_553981 URS0000C6CC3E_1734396
Length 82. 82. 82. 84.
Similarity - 0.983 0.983 0.981
Ensemble Norm 0.992 - - -
MFE -12.909 -19.766 -18.354 -12.724
Ligands - zmp-ztp fluoride cyclic-di-GMP
Gene EPB41L3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.004 3.004 14.
Length SE - 0. 0. 4.
Lev Distance - 20. 22. 16.
UBS 6. 5. 5. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 1. 0. 0. 0.
H 3. 4. 3. 3.
BL 0. 1. 1. 0.
BR 2. 0. 2. 0.
UN 0.280 0.341 0.220 0.286

Sequences

Field Description
UTR seq + 25 aucaaugagacuccuuucucaaguugaacugcauugcgaguaauaucagcauaaaaaATGACGACCGAATCTGGATCAGACT
UTR dot + 25 …..(((((……))))).((((((((((…)).)))….)))))…………(((((….))).))…..
RS 1 seq AGCAAUAGGCGCGACUGGUGUCAUACAUGGGAAACCAUGAGGAAGCGCAAGCAAAUAAAAACCGCACACCUGGGUUGAAAAA
RS 1 dot …….(((((…..)))))…(((((….)))))…..((….))…….((((.((….))))))……
RS 2 seq CUAGUCGUUGGAGAUGGUAUUCUCCUAUCACUUCAGGUUAUAAACUGUGUGUGGUUUGCCCACUAAUAAUGCCUAUUAGUUU
RS 2 dot ………(((((……))))).((((((.(((……..))).).)))))……(((((((…..)))))))..
RS 3 seq AGAUAUCGAGGGGAUUUUGAAGCAUGUAUUUUAUUUGGGCGCUUGAUACAUGUGGAAUAAGUAGCGCAACCGACCUGGUUUAUA
RS 3 dot …..(((((…..))))).(((((((((…………..)))))))))…………..((((…..))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table