Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA035760 Similarity: 0.983 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA035760
Gene: EPB41L3_1
MFE: -11.838
ENS: 0.982
Length: 85.
Predicted Ligands:
zmp-ztp - 9/20
glycine - 8/20
homocysteine - 1/20
RS: URS0000C56694_1849176
MFE: -25.196
Ligand: glycine
Species: Clostridium sp. W14A Glycine riboswitch
RS: URS0000C84CF6_1453999
MFE: -25.031
Ligand: glycine
Species: Candidatus Accumulibacter sp. SK-02 Glycine riboswitch
RS: URS0000C5DFDF_1736327
MFE: -28.031
Ligand: glycine
Species: Rathayibacter sp. Leaf296 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA035760 URS0000C56694_1849176 URS0000C84CF6_1453999 URS0000C5DFDF_1736327
Length 85. 86. 86. 87.
Similarity - 0.983 0.983 0.982
Ensemble Norm 0.982 - - -
MFE -11.838 -25.196 -25.031 -28.031
Ligands - glycine glycine glycine
Gene EPB41L3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.049 3.001 3.003
Length SE - 1. 1. 4.
Lev Distance - 20. 21. 19.
UBS 4. 3. 4. 5.
BS 0. 1. 0. 0.
ILL 1. 1. 2. 1.
ILR 2. 1. 3. 2.
H 1. 2. 1. 1.
BL 1. 0. 0. 2.
BR 0. 0. 0. 1.
UN 0.059 0.279 0.093 0.115

Sequences

Field Description
UTR seq + 25 gaucacagaugagcagaaauagugcagcuguauugaccauuacucaaagaacaaucaaccATGACGACCGAATCTGGATCAGACT
UTR dot + 25 ((((.((((((((……((((((….))))))…….))))……………………..))))))))…..
RS 1 seq AUGAAGAUUCCGGGAGAGACCGUCUGUCACAGACGGCGCCGAAGGGGAACGCAAAAACUCUCAGGCAAAAAAACCGGGAUCCGACG
RS 1 dot …..((((((((……(((((((…))))))).(((..((((………..))))..)))…….))))))))…..
RS 2 seq GCAGCGCGAAUGGGAGAGUGCGGAAUACCGCCGCCGAAGGCGCAAUCCACCCGGAAACGCUCAGGCACAAGGACCGUUCGUGAAUU
RS 2 dot ….(((((((((….(((((((….((((……))))…)))…………….))))…..)))))))))….
RS 3 seq AUACGCGACGCGGGAGAGCCGACUCCGUCGGCACCGAAGGAGCAAGCCUCCCCGCCAAUCUCUCAGGUCUUGUACCGCGUCGAACUG
RS 3 dot …..(((((((((((.((…((((.(((….))).))))…)))))))……………………))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table