Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA035821 Similarity: 0.978 Similarity: 0.978 Similarity: 0.977
UTR: 5HSAA035821
Gene: EPB41L3_2
MFE: -26.011
ENS: 0.879
Length: 92.
Predicted Ligands:
TPP - 9/20
glycine - 4/20
zmp-ztp - 4/20
 RS: URS0000C4168A_742743
MFE: -19.651
Ligand: glycine
Species: Dialister succinatiphilus YIT 11850 Glycine riboswitch
 RS: URS0000DB34EB_1185767
MFE: -18.172
Ligand: TPP
Species: Zunongwangia atlantica 22II14-10F7 TPP riboswitch (THI element)
 RS: URS0000AB991D_525310
MFE: -21.033
Ligand: TPP
Species: Lactobacillus brevis subsp. gravesensis ATCC 27305 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA035821 URS0000C4168A_742743 URS0000DB34EB_1185767 URS0000AB991D_525310
Length 92. 93. 93. 91.
Similarity - 0.978 0.978 0.977
Ensemble Norm 0.879 - - -
MFE -26.011 -19.651 -18.172 -21.033
Ligands - glycine TPP TPP
Gene EPB41L3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.001 3.001 2.
Length SE - 1. 1. 1.
Lev Distance - 26. 28. 29.
UBS 8. 8. 7. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 1.
ILR 1. 1. 1. 1.
H 2. 3. 2. 2.
BL 3. 3. 3. 3.
BR 4. 2. 3. 4.
UN 0.065 0.097 0.097 0.077

Sequences

Field Description
UTR seq + 25 gcagagggaagguaguggcacggagugaccugcucuucccuuuuuucugcuugcagaacaaucaaccATGACGACCGAATCTGGATCAGACT
UTR dot + 25 ..(((((((((((((.(.(((…))).))))).)))))))))..((((..(.((((….((………))…..)))).).))))..
RS 1 seq CGGACACACUCUGGAGAGUCUCGAUUAAAGAGCGCCGAAGGUGUAAGGAUGGCAGCAUCCCAAUCUCUCAGGCAAAAGGACAGAGAAAGCAGC
RS 1 dot …((((.((.(((…(.(((…….)))).))).))))))..(((((….)))))(..(((((………….)))))..)….
RS 2 seq AUCUCGCUUUAGGGGUAUUCUGAAAAGAAUUGAGAGAGUCCCUUUGAACCUGAUGCAGUUUAAACCGUCGUAGGGAAAAGUGUAUUGAGCUUA
RS 2 dot …..(.((((((((.(((((………….))))).)))))))))((((((((.(((…((……))..))).)))))).))….
RS 3 seq AUUCGUGGUCUAGGGUGCCUUUAAUGGCUGAGAAAUACCCAUGGAACCUGCUGCAGUUAGUACUGUCGAAGGAAGAUCGAGUAAUUAGCAU
RS 3 dot ……(((((((((((((……)))……..)))).)))).))(((((..((((.(.(.(((…….))).)).))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table