Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA036090 Similarity: 0.892 Similarity: 0.891 Similarity: 0.888
UTR: 5HSAA036090
Gene: EPHA7_0
MFE: -57.927
ENS: 0.962
Length: 268.
Predicted Ligands:
cobalamin - 16/20
glucosamine - 2/20
unknown - 1/20
 RS: URS0002328AE2_1004785
MFE: -70.589
Ligand: cobalamin
Species: Alteromonas macleodii str. 'Black Sea 11' Cobalamin riboswitch
 RS: URS0000C7EF93_747377
MFE: -64.399
Ligand: cobalamin
Species: Clostridium sp. DMHC 10 Cobalamin riboswitch
 RS: URS0000BFCB7D_926550
MFE: -97.226
Ligand: glucosamine
Species: Caldilinea aerophila DSM 14535 = NBRC 104270 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA036090 URS0002328AE2_1004785 URS0000C7EF93_747377 URS0000BFCB7D_926550
Length 268. 266. 267. 267.
Similarity - 0.892 0.891 0.888
Ensemble Norm 0.962 - - -
MFE -57.927 -70.589 -64.399 -97.226
Ligands - cobalamin cobalamin glucosamine
Gene EPHA7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 16.005 20.006 28.004
Length SE - 4. 1. 1.
Lev Distance - 128. 132. 130.
UBS 14. 17. 17. 18.
BS 0. 0. 0. 1.
ILL 4. 5. 6. 6.
ILR 4. 5. 6. 5.
H 4. 5. 5. 5.
BL 5. 5. 6. 6.
BR 6. 4. 5. 8.
UN 0.157 0.083 0.082 0.090

Sequences

Field Description
UTR seq + 25 uuauuggaguguggagcaagcggccggucugcagucggagacuugcaggcagcaaacacggugcgagcgaacaggagugggggggaaauuaaaaaaagcuaaacguggagcagccgaucggggaccgagaaggggaaucgaugcaaggagcacaauaaaacaaaagcuacuucggaacaaacagcauuuaaaaauccacgacucaagauaacugaaaccuaaaauaaaaccugcucaugcaccATGGTTTTTCAAACTCGGTACCCTT
UTR dot + 25 …((.((.((((((.(……..).)))))).)).))…((((..(((.(……).)))..))))………………………(((……..)))……..((((((((((..(((((((((.((((..(((((………………(((((………………………………)))))……………))))).))))…)))))))))…)))))).)))).
RS 1 seq UAUAAUCGAUGGCGUGUAGGUGCUCUUGUCUAACGCCAUAUUAACUACGGUGACAAGGGUUAAACGGGAAAUCAGUGAAAAGCUGAUGCUGCCCCCGCAACGGUAAACUCAACGCAUUGUCGUUUUCUUUUCAUACGCCACUGUCUUUUAUACGUUUACGCGCGCUCCUGCGUAGCUAAACGCCAAUAGAUGGGAAGGCAAAAGAGCCAUUACAUACUUGGUAAUGGUGAGUAAGCCCGGAUACCGGCCUGUACUUCAUGGUGUCG
RS 1 dot ……..(((((((.((((……..)))))))))))…(((.((((((….(((((…((((..((((((…..))))))……))))……..)))))….)))))).)))(((((((…..(((.((((((……((((((.((((((….)))).))))))))…..))))))…))))))))))(((((((…….))))))).(((((((.((((…)))).)).)))))……….
RS 2 seq AAGGGAAUGUGGUAUAUGCCACAGCAGCCCCCGCUACUGUAAUCAUAGACGAAUGAUUUGUAGGUAUAUGGUGGAACCACCGUAAAACUAAUCUAUUUAUGUUCUAAAAUCCUAAUUUUUAAGGAAUUAUGUACAUAUAUAGAUUUUACUUGAGCUGGUUUCAAUGAGUAUAUCUUUAACGCCACUCAUUUUUAAGGUGAUUUCUAUAGUAAUUAUCUUAAUUUGGGGAAGGUAAAUCAUGAGGAUGAAGUGAAAGCCAGGAUAUCU
RS 2 dot ..(((..((((((….))))))….)))…((((…((((((……)))))).))))((.(((((((….)))))))..)).(((((((.(((((…….((((……..))))…….))))).)))))))………(((((((…(.(.(.((((((((..(((.((((…(((((((((((……..)))))))))))..))))…)))……)))))))).).).))))))))…….
RS 3 seq UCGGGAAAGAGAGCGCAUGGCCCGCACAUGUUGAUCCGUGCGGGUGACGAGGAAGGGGUUUCUGGCGCACGCCAGACUAACCGUGUACAGGGUGAGUCCUGCACGCGGGAAAAUCGAACGAUCAGCGGAUGCCCCUGGGUCGCCUUCCACCGGCCCAACCUGGACAUAUACGUCCAGAAAAAUCUUUCCCACAUCUCAACUCCUGCGUAAGCGUGCGCGGAAAAACGGCGGGCAACUGUCGUUACAAAGACGCACGCAGUGGAAGUC
RS 3 dot ..((((((((…(.(.(.((((((((……….)))))))).).).)…(((((.((((..(..((…((….((((((.((((……)))).))))))…..))…))..)..)))).)))))(((((((……..)))))))..((((((……))))))…..))))))))……..(((.((((….((((((((…..((((((((….))))))))…..).))))))).)))).))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table