Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA036248 Similarity: 0.961 Similarity: 0.960 Similarity: 0.960
UTR: 5HSAA036248
Gene: EPS8
MFE: -13.276
ENS: 0.933
Length: 132.
Predicted Ligands:
cobalamin - 8/20
TPP - 4/20
glycine - 3/20
 RS: URS0000C5FC3A_1171377
MFE: -31.185
Ligand: glycine
Species: Bibersteinia trehalosi USDA-ARS-USMARC-192 Glycine riboswitch
 RS: URS0000AB4C25_880072
MFE: -50.562
Ligand: Mn2+
Species: Desulfobacca acetoxidans DSM 11109 yybP-ykoY manganese riboswitch
 RS: URS0000C79015_345341
MFE: -50.483
Ligand: TPP
Species: Kutzneria sp. 744 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA036248 URS0000C5FC3A_1171377 URS0000AB4C25_880072 URS0000C79015_345341
Length 132. 132. 133. 131.
Similarity - 0.961 0.960 0.960
Ensemble Norm 0.933 - - -
MFE -13.276 -31.185 -50.562 -50.483
Ligands - glycine Mn2+ TPP
Gene EPS8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 16.003 17.003 7.004
Length SE - 0. 1. 1.
Lev Distance - 48. 47. 51.
UBS 4. 7. 6. 6.
BS 0. 0. 0. 0.
ILL 1. 3. 1. 2.
ILR 2. 3. 0. 2.
H 2. 3. 5. 3.
BL 0. 1. 0. 0.
BR 0. 0. 0. 1.
UN 0.242 0.295 0.188 0.305

Sequences

Field Description
UTR seq + 25 uuaaaaauagccaacaauguccuaucaaaguauaauuuguuuuccuagccuagguuuauauuuuuuaaauuuuaaguuaauuauuugucuuuuuauagaaacaaaggATGAATGGTCATATTTCTAATCATC
UTR dot + 25 ..((((((((((………….((((……))))………….)))…)))))))…………..((((((((((((((………))))))))))))))…………….
RS 1 seq GGACGAACCCUUGGAGAGAUCCAAUCCGUCAUUGUUACCCCAAUGGGUAAAUAGGAAAAUGGACGCCGAAGGCGCAAGCGUUAGCUGUUUAGGCAAUGUGAAACGCUCAGGCAAAAGGACAGGGGAGAAAAG
RS 1 dot .((((…..(((((….)))))..))))….((((((….))))))…………..(((…((((…(((((.(((…..))))))))….))))..)))………………..
RS 2 seq CUCCUUAGCAGAGGGGAGUAGCUGCUCCGGACAACGUCAACAUACUGGCAAAAGCCUGGCGUUGUCGGCAAGAUCAUGCUCAGCGAGACUUUUGCACCGAUGGUGCAAAGGUCUUUUUUUUUCCCAGGAGUCU
RS 2 dot ..((((….))))(((((….))))).((((((((((…….(((….)))))))))))))((((……))))….((((((((((((((…))))))))))))))………………
RS 3 seq UGAACACACCGCGGGAGCUCGCGCCACAAGCGGGCUGAGAGGGCGGCUGGAUCGACUUUUCGAUCCGGUGCCGCCGACCGCCUGAACCUGUACUGGGUAAUGCCAGCGUAGGGAGGAAUCGCCAUGACGUC
RS 3 dot ……………(((((((…….)))))))…..((((((((((((((….))))))))..))))))…..(((…((((..((((……))))..)))).)))……………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table