Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA036289 Similarity: 0.981 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA036289
Gene: EPSTI1
MFE: -31.836
ENS: 0.925
Length: 88.
Predicted Ligands:
SAM - 8/20
TPP - 8/20
GMP - 1/20
 RS: URS0000D6AE44_12908
MFE: -22.820
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000C77822_1121014
MFE: -35.417
Ligand: homocysteine
Species: Arenimonas donghaensis DSM 18148 = HO3-R19 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000AB2472_441768
MFE: -16.623
Ligand: SAM
Species: Acholeplasma laidlawii PG-8A SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA036289 URS0000D6AE44_12908 URS0000C77822_1121014 URS0000AB2472_441768
Length 88. 87. 88. 89.
Similarity - 0.981 0.980 0.980
Ensemble Norm 0.925 - - -
MFE -31.836 -22.820 -35.417 -16.623
Ligands - GMP homocysteine SAM
Gene EPSTI1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.001 10.016 6.012
Length SE - 1. 0. 1.
Lev Distance - 21. 23. 24.
UBS 6. 7. 7. 5.
BS 0. 0. 0. 0.
ILL 0. 2. 2. 0.
ILR 2. 3. 2. 1.
H 2. 2. 3. 2.
BL 4. 2. 2. 2.
BR 1. 1. 1. 1.
UN 0.239 0.276 0.114 0.348

Sequences

Field Description
UTR seq + 25 cuaagcgucccagccgcaucccucccgcagcgacggcggcccgggacccgcgggcugugaaccATGAACACCCGCAATAGAGTGGTGA
UTR dot + 25 ……(((((.(((((.((.((…..)).))..)))))..)))))..(((((.(((………))))))))………….
RS 1 seq GAUAUAACUGGGUGCGAUGAACUGCGGGGGUACGAUUCCGGCCACCAAGUCCGCAGGGAGUAAAUGGUGGGACCGACCAGUGAGCGA
RS 1 dot …….(((((..((.((..((…))..))))..)))))(((((((.(((….))).)…))))))……………..
RS 2 seq CCCGCCGAGGGGCGCUGCAAGCCCGGCCCCGCAAGGGGGCAAGGGAUCAGGCUCGGCGAAGGUUCCCGUACAACCGCGCCCGUUAACU
RS 2 dot (((…..)))((.(((….(((.(((((…..)))))..)))..)))))..((((..((((…….)))).))))……..
RS 3 seq CUACCAUAAAGAGAAGGUUAGAGACAAGCUCUAUGACCCUUCAGCAACCUGCAAAACUAAGUAAGGUGCUAAUGCUUGAAUGAUGGAUA
RS 3 dot …………(((((.(((((…..)))))….)))))(((.((((((……..))).))))))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table