Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA036421 Similarity: 0.990 Similarity: 0.989 Similarity: 0.988
UTR: 5HSAA036421
Gene: ERCC1
MFE: -8.242
ENS: 0.937
Length: 47.
Predicted Ligands:
preQ_1 - 10/20
SAM - 5/20
glutamine - 3/20
 RS: URS0000D99644_574375
MFE: -11.087
Ligand: SAM
Species: Bacillus gaemokensis SAM riboswitch (S box leader)
 RS: URS0000DA9B35_163877
MFE: -9.292
Ligand: preQ_1
Species: Virgibacillus necropolis PreQ1 riboswitch
 RS: URS0000AB159F_221109
MFE: -7.342
Ligand: preQ_1
Species: Oceanobacillus iheyensis HTE831 PreQ1 riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA036421 URS0000D99644_574375 URS0000DA9B35_163877 URS0000AB159F_221109
Length 47. 48. 48. 47.
Similarity - 0.990 0.989 0.988
Ensemble Norm 0.937 - - -
MFE -8.242 -11.087 -9.292 -7.342
Ligands - SAM preQ_1 preQ_1
Gene ERCC1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.001 2.012 3.011
Length SE - 1. 1. 0.
Lev Distance - 13. 13. 15.
UBS 2. 2. 2. 1.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 0.
ILR 1. 1. 1. 0.
H 1. 1. 1. 1.
BL 0. 0. 1. 0.
BR 0. 0. 0. 0.
UN 0.340 0.375 0.229 0.234

Sequences

Field Description
UTR seq + 25 uuuggcgacguaauucccgacuATGGACCCTGGGAAGGACAAAGAGG
UTR dot + 25 ………((..((((((………..))))))..))…….
RS 1 seq UACUUAUCCAGAGAGGUAGAGGGACUGGCCCUAUGAAACCUCAGCAGC
RS 1 dot …………(((((..((((…..))))…..)))))……
RS 2 seq ACGGGAGAGGUUCUUAGCUUUUAACCCUCUAUAAAAAACUAAGGACAG
RS 2 dot ………((((((((.(((((……..)))))..))))))))..
RS 3 seq UUGUUAGAGGUUCUUAGCUUCAACCCUCUAUAAAAAACUAAGGACAA
RS 3 dot ………((((((((………………..))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table