Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA036502 Similarity: 0.971 Similarity: 0.970 Similarity: 0.970
UTR: 5HSAA036502
Gene: ERCC6L
MFE: -28.022
ENS: 0.914
Length: 122.
Predicted Ligands:
FMN - 19/20
cobalamin - 1/20

 RS: URS000233183D_742818
MFE: -50.063
Ligand: cobalamin
Species: Slackia piriformis YIT 12062 Cobalamin riboswitch
 RS: URS0000D8FA0E_1739315
MFE: -31.688
Ligand: FMN
Species: Globicatella sp. HMSC072A10 FMN riboswitch (RFN element)
 RS: URS0000C58554_1071400
MFE: -31.019
Ligand: FMN
Species: Lactobacillus buchneri CD034 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA036502 URS000233183D_742818 URS0000D8FA0E_1739315 URS0000C58554_1071400
Length 122. 123. 122. 122.
Similarity - 0.971 0.970 0.970
Ensemble Norm 0.914 - - -
MFE -28.022 -50.063 -31.688 -31.019
Ligands - cobalamin FMN FMN
Gene ERCC6L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.002 0.010 3.010
Length SE - 1. 0. 0.
Lev Distance - 35. 40. 39.
UBS 7. 7. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 2. 0. 2. 2.
H 5. 6. 5. 5.
BL 1. 1. 1. 0.
BR 0. 1. 0. 1.
UN 0.139 0.098 0.238 0.238

Sequences

Field Description
UTR seq + 25 gcgaaauucaagcuccaaacucuaagcuccaagcuccaagcuccaagcuccaagcuccaaacucccgccgggguaacuggaacccaauccgagggucATGGAGGCATCCCGAAGGTTTCCGG
UTR dot + 25 ……….((((……….))))…((((…((((…))))…))))(((.(((((….)))))…))).((((…….))))..(((((((………))))))).
RS 1 seq GCUUCCUGCGAAGCCAUUGGUUUCGGGGUGUUUCCUCGGAACAAGAGGGAAUGAGGGUGAGAAUCCCUCGCUGUACCAGCAACCGUAAAGCACCGGGGACGCUGCCGACGACAAGGGCAGCGC
RS 1 dot …..((.(((((((…))))))).)).((((((((…….))))))))(((((…….)))))((((…))))..(((……..)))…(((((((………))))))).
RS 2 seq AAAAGUCUUCAGGGCAGGGUGUAAUUCCCGACCGGUGGUAAAGUCCACGAGCUAAUGGUGUCAUUAGUUGAACUGGUGUAAUUCCAGUACCGACAGUAAAGUCUGGAUGGGAGAAGAUGGAU
RS 2 dot …………((..(((…….)))..)).((((……)))).((((((((….))))))))..(((((…….))))).(((.(((……)))..)))…………
RS 3 seq GUUUAUCUUCAGGGCAGGGUGUGAUUCCCGACCGGCGGUGAUAGUCCGCGACUCACGAGUGAUCGUGCUGAGCUGGUGAAAUUCCAGUGCCGACAGUAAAGUCUGGUAUGUAGAAGAUUAAA
RS 3 dot …………((..(((…….)))..)).((((…….))))..(((((((….))))…)))((((…….))))(((((((……))).))))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table