Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA036507 Similarity: 0.964 Similarity: 0.959 Similarity: 0.958
UTR: 5HSAA036507
Gene: ERG
MFE: -16.413
ENS: 0.979
Length: 149.
Predicted Ligands:
cobalamin - 7/20
glucosamine - 5/20
FMN - 4/20
 RS: URS0000C17D3E_1262955
MFE: -43.076
Ligand: FMN
Species: Ruminococcus sp. CAG:353 FMN riboswitch (RFN element)
 RS: URS000008E5DC_1111120
MFE: -43.805
Ligand: glucosamine
Species: Acidaminococcus sp. BV3L6 putative glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000D8F619_708126
MFE: -28.715
Ligand: lysine
Species: Trichococcus sp. EX-07 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA036507 URS0000C17D3E_1262955 URS000008E5DC_1111120 URS0000D8F619_708126
Length 149. 148. 150. 148.
Similarity - 0.964 0.959 0.958
Ensemble Norm 0.979 - - -
MFE -16.413 -43.076 -43.805 -28.715
Ligands - FMN glucosamine lysine
Gene ERG - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.043 10.084 8.061
Length SE - 1. 1. 1.
Lev Distance - 43. 51. 53.
UBS 5. 8. 7. 7.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 0. 1. 2. 1.
H 4. 5. 4. 5.
BL 1. 2. 0. 0.
BR 1. 2. 1. 1.
UN 0.456 0.250 0.167 0.209

Sequences

Field Description
UTR seq + 25 uucauuucccagacuuagcacaaucucauccgcucuaaacaaccucaucaaaacuacuuucuggucagagagaagcaauaauuauuauuaacauuuauuaacgaucaauaaacuugaucgcauuATGGCCAGCACTATTAAGGAAGCCT
UTR dot + 25 …………….(((…………)))……………….((.((((((….)))))).))……………………..(((((((…..)))))))……(((…………….))).
RS 1 seq AAUUUGUUUCAGGGCGAGGUGAAAUUCCUCACCGGUGGUAUAGUCCACGAGCUUUUCCGAAAGGGAGAGCAUGAUUCGGUGCAACUCCGAAACCGACGGUAAAUGUCAGGCUUACGCUUGUCACAAGUCCGGAUGAAAGAAACACAGC
RS 1 dot …………((.((((…….)))).)).((((……))))..((((((((….))))))))…..(((((………..)))))(((….((.(((((….))))).))…..)))……………..
RS 2 seq GCAAGGCCUAGAGCGCAAGUGCCUAUCCUGAUAGGCAGACGAGGAAGAGGCUUAUCGAACCGUCAGCGGAUACCUCUCGGUGUGCUGCAACCGUAAACAGAUGACAAACCUUUCCGGUAACGGGAAGAACAGAGAGUCUGGGGCAGACGG
RS 2 dot …((((((……….(((((((….)))))))……….))))))……..(((((((((((((….))))).))))………….))))….(((((((….)))))))……..(((((…)))))..
RS 3 seq AUAUGAACCAGAGGCCGCGAAAACCAAGAGUAGGAAACGAAAGGGGAAUUCGCCGAAGUAUCGAAUGUGAUACUGGGAUUAUACUGAAUAAGUAUAAUACUGUCAGAAUAAAAUGCCCAAUUUUAUUCAUUGAUGAGCUGUUCAUGUU
RS 3 dot …………….(((((..((……………….))..)))))…(((((((….))))))).((((((((((…..)))))))).))….(((((((((…..)))))))))….((((…..))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table