Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA036513 Similarity: 0.958 Similarity: 0.957 Similarity: 0.957
UTR: 5HSAA036513
Gene: ERGIC2
MFE: -49.213
ENS: 0.983
Length: 158.
Predicted Ligands:
glucosamine - 13/20
FMN - 3/20
SAM - 1/20
 RS: URS0000C8373E_1221996
MFE: -37.437
Ligand: SAM
Species: Quasibacillus thermotolerans SAM riboswitch (S box leader)
 RS: URS0000D7C63E_329046
MFE: -36.442
Ligand: TPP
Species: Rhizoclosmatium globosum TPP riboswitch (THI element)
 RS: URS0000D79768_1797201
MFE: -71.878
Ligand: glucosamine
Species: Actinobacteria bacterium RBG_16_67_10 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA036513 URS0000C8373E_1221996 URS0000D7C63E_329046 URS0000D79768_1797201
Length 158. 158. 155. 158.
Similarity - 0.958 0.957 0.957
Ensemble Norm 0.983 - - -
MFE -49.213 -37.437 -36.442 -71.878
Ligands - SAM TPP glucosamine
Gene ERGIC2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 2.002 4.019
Length SE - 0. 9. 0.
Lev Distance - 54. 45. 57.
UBS 9. 9. 9. 10.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 2. 2. 2. 2.
H 4. 5. 3. 4.
BL 3. 1. 4. 2.
BR 2. 2. 2. 3.
UN 0.247 0.259 0.290 0.108

Sequences

Field Description
UTR seq + 25 agucgcuuuuguucucgcgauauuuccggguacgcgggagccccggcgacccgggcuucugugaaacauggcgguaggcugggaccauaacacaagcaugacuauaugaaggaagaggaagguuuuccugaagATGAGGCGACTGAATCGGAAAAAAA
UTR dot + 25 .((((((…(((((((((.((((….)))))))))))))…))))))((.(((((((((……..)))).))))).))……………………..(((((((……)))))))…(((.((….))..)))………
RS 1 seq CUCUUAUCCUGAGCUGGCGGAGGGACAGGCCCAAUGAAGCCCGGCAACCUGCUUGAUCCUAAGGAAGCGGAGGUUGUUUAUCAAUCGCUUCUAUAUCUACAUAUUUUCAAGACAAAGGUGCCAACCUGCAGCAAGGGAAAAACCUUGAACGAUAAGAG
RS 1 dot ((((…((……)).))))((((((((….((……..))….))))).)))…((((((((.(((…..)))..))))))))…………………..((((….))))….(((((……)))))………..
RS 2 seq UUGAGCAAAAACGGGAGCCAAUACUGUUGCGCAGUUUGUUUCUUUUGUUUUGUUUGUUUUCCUUUGUUUGCCUUCUGUUUGCGCAGGCUGAGAAGUUUAUAACCGUUUGACCGGAACACGGUAAUUCGUGCGUCGGGAUUUUGCUCAAUAAAAUA
RS 2 dot ..((((.((((((((((.(((.(((((…))))))))…))))))))))))))……(((.(((((((……..).)))))).)))………………((((..(((((….)))))..))))……………….
RS 3 seq AGACGUUCUCGAGCGCCUGGCCUCCCCACGGGGGAGGUGACGAGGAAGAGGGUCAUCGAAAGACUCGGCGGAUACCCUCUCGGCCGCUCACGGCCGUGACGGUGCGGAGCAAACCCCGGGGGCGACCCCGGUGCAUAGAAGCCGCAUCGAUGUGAGGC
RS 3 dot …..((((((……(.((((((((…)))))))).)))))))((((((((.((((…..)))).)…)))))))((((((….))))))…((((((((…….(((((((….)))))).)……..))))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table