Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA036514 Similarity: 0.950 Similarity: 0.948 Similarity: 0.946
UTR: 5HSAA036514
Gene: ERGIC2_0
MFE: -58.755
ENS: 0.884
Length: 194.
Predicted Ligands:
cobalamin - 17/20
lysine - 2/20
glucosamine - 1/20
 RS: URS0002317978_398511
MFE: -46.693
Ligand: cobalamin
Species: Bacillus pseudofirmus OF4 Cobalamin riboswitch
 RS: URS0002322863_1637974
MFE: -38.390
Ligand: cobalamin
Species: Bacilli bacterium VT-13-104 Cobalamin riboswitch
 RS: URS00023346A9_1915078
MFE: -70.885
Ligand: cobalamin
Species: Thioclava nitratireducens Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA036514 URS0002317978_398511 URS0002322863_1637974 URS00023346A9_1915078
Length 194. 195. 192. 195.
Similarity - 0.950 0.948 0.946
Ensemble Norm 0.884 - - -
MFE -58.755 -46.693 -38.390 -70.885
Ligands - cobalamin cobalamin cobalamin
Gene ERGIC2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.001 4. 11.001
Length SE - 1. 4. 1.
Lev Distance - 58. 61. 64.
UBS 14. 13. 13. 14.
BS 0. 0. 0. 0.
ILL 1. 3. 2. 3.
ILR 3. 3. 3. 2.
H 6. 6. 5. 7.
BL 6. 4. 5. 4.
BR 3. 1. 3. 2.
UN 0.149 0.118 0.156 0.118

Sequences

Field Description
UTR seq + 25 auuuccggguacgcgggagccccggcgacccgggcuucugugaaacauggcgguaggcugggaccauaacacaagguuauugucauaggauaaauuccucaaugggcauuuacuuagaagaggaguggugugcaugacuauaugaaggaagaggaagguuuuccugaagATGAGGCGACTGAATCGGAAAAAAA
UTR dot + 25 ….((((((.(((.((….)).)))))))))((((((((……..)))).))))…((((………))))…(((((.(.(((.(((((((..((((……))))…)))))))..))).))))))…….(((((((……)))))))…(((.((….))..)))………
RS 1 seq UUGUUUUUGCGGAAUGUUGGUGCUGCUAGGCAGCUUAAUAGGGAAUCUGGUGAAAAUCCAGAACUGUCCCCGCAACUGUAAGUGUGGAUGAAAUGAGACAACCACUGUAUAAGAGAGCUGAAAGGUGCUUAUACGGGAAGGCUCAGAGUAAAGAGAAGCACAAGUCAGGAGACCUGCCAUCAUUUCUCAGUCAGC
RS 1 dot ((((….))))..((((((.(((((…))))))))))).(((.(((((…….)))))….)))(((((……..)))))……((((….((.(((((((((…(((….))).)))))))))…))))))…….((((((…..(.((((…)))))…..))))))…….
RS 2 seq UAUAGUGAAUAGACGAAUGGUGACUGUAGUCUUAAUAGGGAAUCUAGUGUAAAUCUAGAACUGCCCCCGCAACUGUAAGUGUUACGAAAGAGAAACCCACUGUAUUAACAGGCAUUAAAGACUGUGAUAUGGGAAGGGCUCUAGUAGGUUUGAUACACAAGUCAGGAUACCUGCCAUUUUUCUUUAGUUUCA
RS 2 dot ((((((.(.((……)).).))))))………(((..(((((…….)))))…..)))((.(((…….))).))..((((…(((.(((((((.((((……….)))))))))))…))))))).(((((((((((……)))))…))))))………………
RS 3 seq CCAAUAUGAUGUUGCUUUGGUUCCUGCGAGUCACUCCGCAGGCGAAGAGGGAAGCCGGUGGAAUUCCGGCGCUGCCCCCGCAACUGUAAGCGGCGAGCCUGAUGUCCGAAUGUCACUGGUGCAAUGCGCCGGGAAGACGGACCGAGAGGCGCUCGAGCCGCGAGCCAGGAGACCUGCCAGAGCAGAUAGACGACG
RS 3 dot .(((((…)))))(((((…((((((……..))))))))))).(((.((.((.(((….))).)))).)))((((……..))))…((((…(((((….((.(((((((…)))))))))…)))))….))))(((((…..)))))……..((((….))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table