Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA036530 Similarity: 0.948 Similarity: 0.947 Similarity: 0.947
UTR: 5HSAA036530
Gene: ERGIC2_1
MFE: -55.239
ENS: 0.855
Length: 184.
Predicted Ligands:
lysine - 12/20
Mg2+ - 4/20
cobalamin - 4/20
 RS: URS0000D91EB7_1834162
MFE: -77.514
Ligand: Mg2+
Species: Mycobacterium sp. SP-6446 M-box riboswitch (ykoK leader)
 RS: URS0000ABC5C4_621372
MFE: -69.956
Ligand: lysine
Species: Paenibacillus sp. oral taxon 786 str. D14 Lysine riboswitch
 RS: URS0000AB88AD_632518
MFE: -68.166
Ligand: lysine
Species: Caldicellulosiruptor owensensis OL Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA036530 URS0000D91EB7_1834162 URS0000ABC5C4_621372 URS0000AB88AD_632518
Length 184. 183. 183. 184.
Similarity - 0.948 0.947 0.947
Ensemble Norm 0.855 - - -
MFE -55.239 -77.514 -69.956 -68.166
Ligands - Mg2+ lysine lysine
Gene ERGIC2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 23.010 20.011
Length SE - 1. 1. 0.
Lev Distance - 67. 59. 62.
UBS 10. 10. 10. 9.
BS 5. 6. 2. 2.
ILL 2. 2. 4. 2.
ILR 1. 2. 2. 3.
H 3. 3. 4. 4.
BL 4. 5. 2. 3.
BR 6. 6. 4. 4.
UN 0.147 0.120 0.049 0.043

Sequences

Field Description
UTR seq + 25 ucuuuucugacguuuucagcugugauagucgcuuuuguucucgcgauauuuccggguacgcgggagccccggcgacccgggcuucugugaaacauggcgguaggcugggaccauaacacaagcaugacuauaugaaggaagaggaagguuuuccugaagATGAGGCGACTGAATCGGAAAAAAA
UTR dot + 25 ((((((((..(((..(((((((((…((((((…(((((((((.((((….)))))))))))))…))))))((.(((((((((……..)))).))))).))…….)))).)).)))….)))..))))))))….((((((.((…(.((….)).).))))))))…
RS 1 seq ACGGCACCUCGUUAGGUGAGGCGUCUACACGAAUACAGGCCACUGACCCCGAACGUCCAAAGACGCCCCGGGUCAGGACAGCUCCUCCUGGCUUAAGGGUUGAGCCCAGGUGGCUUCCGGCUCGGAUUGUUUCCGGCCAGGACACGUCGUGUAGUGCCGAAGCUCUGACGAGUGGGGUGCGGA
RS 1 dot .(.((((((((((((((..((((.((((((((…..(((..(((((((.(..((((….))))..).)))))))….)))((.((((((((((…))))))).))).))..((((((.((((…..))))))).)))….))))))))))))…)).)))))))….))))).).
RS 2 seq UGGUGGGGUAGAGGCGCGAUAUUUAACAGUCUUCGGUGGAGCUUGAGCAGGCGAUGAGCCCGGGGAGAAGGAAAUGUCGCCGAAGCGGUAUACAGGCUCACUGUAUGCUGCUGGGCCUGCAGUUAAUAGCUGCAGGACUGUCUUGGUAGAUGACCCGAUCUAUCAAGUUGCGCUAUCUCGUCG
RS 2 dot .((((((((((..(((((((((((..(..(((((..(((.(((((.(….)..)))))))).)))))..)))))))))((..((((((((((((…..)))))))))))).))(((((((((…)))))))))…..((((((((((……)))))))))).))).)))))))))).
RS 3 seq UUAAUAGAUAGAGGCGCGUCUUUUAAGAGUAGGCAGGCGGAUGUGAAAGAAGACACAGAUGAAACCUGCUGAAAGGAAAAGACGCCGAAGGGAGUUUCUUUCUUCUUGGAAACUUCCCUGGGUGCAUGGAGAAUAUCCAUGCAACUGUCACCAAUUGUAAAAUUGGUGGAGCGCUAUCUGUUAA
RS 3 dot .((((((((((..((.((((((((…….((((((((..((((……..))))..))…))))))……))))))))((.(.((((((((((……..)))))))))).).))((((((((…..))))))))….(((((((((….))))))))).)).)))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table