Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA036688 Similarity: 0.948 Similarity: 0.947 Similarity: 0.946
UTR: 5HSAA036688
Gene: ERP27
MFE: -41.924
ENS: 0.967
Length: 176.
Predicted Ligands:
lysine - 8/20
cobalamin - 5/20
FMN - 2/20
 RS: URS000231D454_103690
MFE: -45.640
Ligand: cobalamin
Species: Nostoc sp. PCC 7120 Cobalamin riboswitch
 RS: URS0000AB505A_469616
MFE: -36.379
Ligand: lysine
Species: Fusobacterium mortiferum ATCC 9817 Lysine riboswitch
 RS: URS0000D8CF34_1615890
MFE: -61.533
Ligand: FMN
Species: Bradyrhizobium sp. LTSP849 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA036688 URS000231D454_103690 URS0000AB505A_469616 URS0000D8CF34_1615890
Length 176. 177. 177. 176.
Similarity - 0.948 0.947 0.946
Ensemble Norm 0.967 - - -
MFE -41.924 -45.640 -36.379 -61.533
Ligands - cobalamin lysine FMN
Gene ERP27 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.015 3. 11.008
Length SE - 1. 1. 0.
Lev Distance - 68. 69. 68.
UBS 9. 9. 9. 11.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 3.
ILR 3. 4. 4. 2.
H 3. 3. 3. 5.
BL 2. 2. 1. 3.
BR 2. 1. 2. 3.
UN 0.051 0.175 0.073 0.142

Sequences

Field Description
UTR seq + 25 gcacagcgaugugagcugaggugcaggcaccagaccuaggaauuccuagaaaaauagucaggaagcauuuagacacaucaaauguuaaacgaguccugauuaugaugauaaugaugaugauuuuggugguugcaauagcaaagccuuaaguATGAAGGAGACTTGCCAGCTGGAAA
UTR dot + 25 .((((….)))).((((…(((((.(((((((……………….(((((((((((((((((.((….)))))))))…….))))))))))………………))))))).))))).))))..(((..(((((………)))))…)))…..
RS 1 seq ACCAUUAAAUAAAUAUUCGGUUCUGGUGGGGAGCAGUCACCAGAGGUAACGGGGAAAGUAUACCUGCAAUCUUUCGUAGGUGAACGGUGUAAGUCCGGCGCUGUCCCGCAACUGUGAAGGAAAGAAAACUCUUGUAACUUUCCCAGUCAGAACGCCCGCCGAAAUUGACGAUUCUCA
RS 1 dot ………………(.(((((((((…….))))))))).)….((((((((…..((((((((((((((((((.(((((((…….)))))))..)))..))))))))))……….))))))))))))).(((((..((…..))…)))))……..
RS 2 seq AAAGCCGAUAGAGGAGCAAAUGACAAGAGUAGGAUUGUGGAGUUUUGCAAACGACGAAACAAUUUGAAAGGGGAUUUUGCCGAAAUGGAAAAGAAGCUAAACUUUUCUGUUGGCAAUAUGAAUAAUAUUCAUAUUGCUGUCAUUGAUAAAAAAGGUCAGUGGAGAGCUAUCUGUGUG
RS 2 dot …(((((((((((((((((………..((((((((..((((…))))..)…)))))))……….)))))………………….))))))))))))(((((((((…)))))))))(((.((((((((…….))))))).).)))……….
RS 3 seq CGAUGUUCUCAGGGCGGGGUGAAAGUCCCCACCGGCGGUAAGGGUCGAAAGGCCUAAGCCCGCGAGCGCCUUCCCCAAGGAUAUUCCUGAGAAAGGGAUAUUCCCAAAGGGAAGGGUCAGCAGAUUCGGUGCAACUCCGAAGCCGACGGUUAAAGUCCGGAUGAAAGAGAACGGUC
RS 3 dot …………((.((((…….)))).)).((((…(((((….)))))….))))…..(((((((…((((((((((…..))))))))))…..)))))))(((.((…(((((…….))))))).)))…….(.(((…………))).)

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table