Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA036895 Similarity: 0.968 Similarity: 0.964 Similarity: 0.964
UTR: 5HSAA036895
Gene: ETV3
MFE: -35.396
ENS: 0.873
Length: 108.
Predicted Ligands:
TPP - 6/20
zmp-ztp - 6/20
methionine - 4/20
 RS: URS0000C2986C_1184609
MFE: -46.497
Ligand: TPP
Species: Kineosphaera limosa NBRC 100340 TPP riboswitch (THI element)
 RS: URS0000D98669_488446
MFE: -43.643
Ligand: fluoride
Species: Burkholderia latens Fluoride riboswitch
 RS: URS0000C2312E_1523425
MFE: -45.039
Ligand: TPP
Species: Novosphingobium sp. AAP83 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA036895 URS0000C2986C_1184609 URS0000D98669_488446 URS0000C2312E_1523425
Length 108. 107. 108. 108.
Similarity - 0.968 0.964 0.964
Ensemble Norm 0.873 - - -
MFE -35.396 -46.497 -43.643 -45.039
Ligands - TPP fluoride TPP
Gene ETV3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 15.002 8.003
Length SE - 1. 0. 0.
Lev Distance - 37. 39. 44.
UBS 13. 12. 11. 12.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 3.
ILR 3. 1. 0. 1.
H 3. 3. 3. 2.
BL 7. 6. 6. 6.
BR 7. 6. 7. 7.
UN 0.074 0.075 0.120 0.019

Sequences

Field Description
UTR seq + 25 gggguggaugaggaggagccggagacgccgcggaggagaccggaccgaagacggaccgugccgggaagagcaggcgggugaaaATGAAAGCCGGCTGTAGCATCGTGG
UTR dot + 25 (.((((..(..((…..))..)..)))).)……..((((.(((….))).))).)(((.((.(.((((.(((.(………).))).))))..).)).)))
RS 1 seq GGGUGCCGCGCGGGGUGUCCCGGCAGGGACUGAGAUGGGCAGCCGCCCAGACCCGUGGAACCUGAUCUCGAUCAAUGCGAGCGGAGGGAACGCGGCGGCCCACGGGG
RS 1 dot .(((.((((.((((….)))))).)).)))….(((((….)))))..(((((((…(((.((.((.((..(.(….).)..)).)).))))).))))))).
RS 2 seq GCCGCCUGCGGAGAUGGCAUGCCUCCCUGCGGUCGAGUCCGGCGCGUCGCGCGCGCGGUCUUCGGCCCUCAACCGCCGGUUCGCCCGGCUGAUGAUGCCUGCGUGUUC
RS 2 dot ..((.((((((.((.((….)))).)))))).))((.((((((((…))))).))).))..(((..(((.(.(((((…..))))).).))).)))………
RS 3 seq GCCCACACCCCGGGGAGCCAGUGUUGGCUGAGAGGGGCAGGUCACGCUGCCCGACCCGUCGAACCUGAACCCGUUAGCACGGGCGGAGGGAGGGCCGGUCCGCUCAAC
RS 3 dot (((.((((…((….)).)))).)))((((..((((.((((.(.((..(((.((((((.(((……..))).).))))))))..)).))))).)))).))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table