Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA037186 Similarity: 0.940 Similarity: 0.937 Similarity: 0.935
UTR: 5HSAA037186
Gene: EXOC4
MFE: -50.809
ENS: 0.752
Length: 186.
Predicted Ligands:
cobalamin - 12/20
lysine - 7/20
Mn2+ - 1/20
 RS: URS0002331BD0_1121895
MFE: -46.516
Ligand: cobalamin
Species: Flavobacterium rivuli WB 3.3-2 = DSM 21788 Cobalamin riboswitch
 RS: URS0002319304_1230342
MFE: -32.230
Ligand: cobalamin
Species: Clostridium tetanomorphum DSM 665 Cobalamin riboswitch
 RS: URS000232C8BA_993047
MFE: -64.124
Ligand: cobalamin
Species: Rhizobium etli CNPAF512 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA037186 URS0002331BD0_1121895 URS0002319304_1230342 URS000232C8BA_993047
Length 186. 188. 187. 187.
Similarity - 0.940 0.937 0.935
Ensemble Norm 0.752 - - -
MFE -50.809 -46.516 -32.230 -64.124
Ligands - cobalamin cobalamin cobalamin
Gene EXOC4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 24.007 32.001 14.015
Length SE - 4. 1. 1.
Lev Distance - 66. 71. 81.
UBS 7. 11. 10. 7.
BS 3. 2. 2. 5.
ILL 1. 2. 3. 0.
ILR 0. 2. 3. 2.
H 4. 4. 4. 4.
BL 3. 4. 3. 4.
BR 4. 3. 1. 2.
UN 0.102 0.186 0.075 0.225

Sequences

Field Description
UTR seq + 25 guucuuggcagggugcagagaggggaucacguaacccaaguguuucccucacagacugacauucaucucaguauucauguuccuugucaaggaaaggauaaagaaggcauaauuaagaaaaugauguuauuauuuuagguuuuagaaaccuguucuuuaucATGGCGGCAGAAGCAGCTGGTGGGA
UTR dot + 25 .((((((((((((.((((((((((((.(((………))).)))))))….(((((……..)))))..)).))).))))))))))))…(((((((((…………………………(((((((…))))))))))))))))..(((.((….)).)))…….
RS 1 seq UAUUUGCAGCGUAAUUUUGGUUGCCAUUUUACAUGGCAUUAAAAGGGAAUUGGGUGAAAAUCCUAAACUGUUCCUGCAGCUGUAAUCUUCAUAAAAAAAGGAUGCUAUAACAAGCCACUGCCAUUUAUGGCGGGAAGGCAUAGCAAUCCGGAGAGAGUCAGAAGACCUGCCAUUUUACAAUUUCAGUG
RS 1 dot …((((((((((.((((((.((((((…..)))))))))))).(((((((((…….))))….)))))))).)))))))…………..(((((((((…..(((.((((((….))))))…))))))))).)))((..((.(((….))))).))……………..
RS 2 seq UUAAAUAUUUUAAAUUUAGGUGCCUAUAAUUUUUGUAGUAUAGGUGAAAAGGGAAUGUGGUUAAAUUCCACAACAGCCCCCGCUACUGUAAUUGAUGACAAGCUCUUAAUAUUCCACUCUGAAAAGGGGAAGGAAAGAGUACGGAGGAAUCAUAAGUCAGGAGACCUGCCUAAAUUUUGAAAAUAGC
RS 2 dot …..(((((((((((((((((((((((……….)))))))…..(((..(((((…….)))))….)))(((.((((.(………………….((((.((((….))))…))))).)))))))(((..((………))..)))))))))))))..))))))..
RS 3 seq GAAAUAGAUGCUCCGUCAGGUGCCCGCCGGUGAGGCGGGAGAAUCGGGAAUCCGGUGCAAGACCGGAACGUGCCCAACGCUGUAAGGCCGACGCCCGCCGCUUUACCAUGCCACUGGCUUUUGCCGGGAAGGCUGCGGCAGACGGAUGACGCCAAGUCAGAAGACCGGCCUGGCAAGAUAGACCCAA
RS 3 dot ………..((((((…(((.(((.((((((((((……((((..((((((…..)))))).((((((………..)))..)))))))))))))))))..(((.(((((….)))))…))).))))))))))))….((((.(((……..))).))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table