Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA037262 Similarity: 0.991 Similarity: 0.990 Similarity: 0.990
UTR: 5HSAA037262
Gene: EXOG
MFE: -10.492
ENS: 0.960
Length: 48.
Predicted Ligands:
glutamine - 11/20
preQ_1 - 4/20
unknown - 3/20
RS: URS0000DB6390_708126
MFE: -8.606
Ligand: preQ_1
Species: Trichococcus sp. EX-07 PreQ1 riboswitch
RS: URS0000D6ADBA_12908
MFE: -13.
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
RS: URS0000E6098E_150033
MFE: -9.981
Ligand: unknown
Species: Enterococcus ratti DUF1646 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA037262 URS0000DB6390_708126 URS0000D6ADBA_12908 URS0000E6098E_150033
Length 48. 46. 49. 48.
Similarity - 0.991 0.990 0.990
Ensemble Norm 0.960 - - -
MFE -10.492 -8.606 -13. -9.981
Ligands - preQ_1 glutamine unknown
Gene EXOG - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1. 6.002 7.016
Length SE - 4. 1. 0.
Lev Distance - 8. 10. 11.
UBS 5. 4. 4. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 1. 1. 1. 1.
H 1. 1. 1. 1.
BL 2. 2. 2. 1.
BR 2. 2. 0. 1.
UN 0.125 0.130 0.082 0.250

Sequences

Field Description
UTR seq + 25 aaaaggccgguaccucgggcaagATGGCTATCAAGAGTATCGCTTCCC
UTR dot + 25 …(((.((((((((.((((……)))..).)).)))))))))…
RS 1 seq AAGCUCGUGGUUCGUUGACCAUCCCACGUAAAAAAACUAGGAGGAG
RS 1 dot …(((.((((((((.(……).)))……))))).)))…
RS 2 seq AUCGUUCAUCCUCUUCGGAGGACGCAAAUGCCGACUGAAGGAACGGGAU
RS 2 dot .((((((…..((((((.((.(……)))..))))))))))))…
RS 3 seq GGUUGGGCUUAUGCUUCAAGGAUUGCGUUCUUCAAGGGGUGAGAAGAA
RS 3 dot …….(((((.(((..((((……))))..))).)))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table