Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA037307 Similarity: 0.985 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA037307
Gene: EXOSC3_0
MFE: -26.788
ENS: 0.946
Length: 73.
Predicted Ligands:
homocysteine - 10/20
fluoride - 5/20
cobalamin - 4/20
RS: URS0000C12924_1678028
MFE: -19.790
Ligand: homocysteine
Species: Massilia sp. NR 4-1 S-adenosyl-L-homocysteine riboswitch
RS: URS0000D9EE05_1121959
MFE: -20.835
Ligand: fluoride
Species: Hymenobacter psychrotolerans DSM 18569 Fluoride riboswitch
RS: URS0000ABCBAB_266264
MFE: -23.599
Ligand: homocysteine
Species: Cupriavidus metallidurans CH34 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA037307 URS0000C12924_1678028 URS0000D9EE05_1121959 URS0000ABCBAB_266264
Length 73. 73. 74. 74.
Similarity - 0.985 0.984 0.984
Ensemble Norm 0.946 - - -
MFE -26.788 -19.790 -20.835 -23.599
Ligands - homocysteine fluoride homocysteine
Gene EXOSC3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.009 5. 18.
Length SE - 0. 1. 1.
Lev Distance - 20. 18. 14.
UBS 7. 6. 7. 7.
BS 0. 0. 0. 0.
ILL 4. 3. 4. 2.
ILR 2. 2. 1. 1.
H 1. 1. 1. 1.
BL 1. 1. 1. 3.
BR 2. 2. 4. 5.
UN 0.027 0.123 0.027 0.041

Sequences

Field Description
UTR seq + 25 gcggaagcggaaggcggguaccggaaacgguguuugguggagcccgcgATGGCCGAACCTGCGTCTGTCGCGG
UTR dot + 25 (((…(((((..((((((..(((..((((.((((….)))))))…)..))).)))))).))))))))..
RS 1 seq UUCUCCGAGGAGCGUUGCGACGAAUCGCCCGAUUCGCCAGGCUCGGAUACUUCUGCAACCGCGCUCACGUUAC
RS 1 dot …..((..((((((((((..(((….((((.((….)).))))….)))))))…)))))).))….
RS 2 seq UGCGCAUACGGUGAUGGAUUUCCACCGCGAACCGCCGAAGCUUCGUGCUUUGCGCUGAUGAUUCCUACUGAGCG
RS 2 dot ..(((…(((((..(((((..((.((((((..(((((….))).)))))))).))..))))).))))).)))
RS 3 seq CACUCCGAGGAGCGUUGCAACGGAUGGCCUCGCCUUCCGCCAGGCUCGGAAUGUUUCAACGGCGCUCGCAGUUC
RS 3 dot .(((.((((..((((((.((((…(((((.((…..)).)))))…..)))).))))).).)))).)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table