Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA037337 Similarity: 0.972 Similarity: 0.972 Similarity: 0.971
UTR: 5HSAA037337
Gene: EXOSC9
MFE: -39.376
ENS: 0.967
Length: 133.
Predicted Ligands:
SAM - 6/20
cobalamin - 5/20
TPP - 4/20
 RS: URS0000AB5EEC_546414
MFE: -39.379
Ligand: SAM
Species: Deinococcus deserti VCD115 SAM riboswitch (S box leader)
 RS: URS0000D8FC8B_512030
MFE: -41.889
Ligand: TPP
Species: Acidovorax sp. NO-1 TPP riboswitch (THI element)
 RS: URS0000C4F0A5_1089553
MFE: -51.562
Ligand: molybdenum
Species: Thermacetogenium phaeum DSM 12270 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA037337 URS0000AB5EEC_546414 URS0000D8FC8B_512030 URS0000C4F0A5_1089553
Length 133. 131. 132. 134.
Similarity - 0.972 0.972 0.971
Ensemble Norm 0.967 - - -
MFE -39.376 -39.379 -41.889 -51.562
Ligands - SAM TPP molybdenum
Gene EXOSC9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.003 5.001 9.001
Length SE - 4. 1. 1.
Lev Distance - 28. 35. 34.
UBS 9. 9. 10. 8.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 2. 3. 1. 1.
H 3. 3. 3. 4.
BL 3. 1. 2. 1.
BR 4. 2. 5. 3.
UN 0.173 0.229 0.197 0.201

Sequences

Field Description
UTR seq + 25 gaugacguaauuuuccugcgccucggggcgagcagcggcgcgcaaggaaagaucggguuccguuuuucccgcggauucuggugccuguggggccggugacccaacaccATGAAGGAAACGCCACTCTCAAACT
UTR dot + 25 ……….(((((((((((.(((……….))).))))).))))))((((((.(((((…….))))).))))))….((((.(((((((……))))…..))…).))))………
RS 1 seq CCUUUAUCCAGAGCGGCGUAGGGAUCUGGCCCAGUUAUCGCCGCAGCAACCGGCCCUCAUCACGGCAUCGGUGCUUGACCAGCCCGCACGCGCCAACGAUGGCUCCACAGUCGCGACGGGAACGAUAAGGG
RS 1 dot …………(((((((((((……)))…)).))))))(((.(((((((……..)))..)))))))…….((((..(((((((….))))………))).))))………..
RS 2 seq CGGACGAAACAGGGGUGUCCCGCCAUUUUGGUGUGCGACUGAGAAAUACCCUGGGGCUACCGCGCACACAGUUGCAUGGCCCCGCUACCCGAUCCAGGUCAUGCUGGCGUGGGGAGUUUCCUUUCAAGCGGC
RS 2 dot ………..((((((((((((((…))))).).)))……..)))))(((((((..(((……..))).)))))))(((.(((.((((((……)))).)).))))))……………
RS 3 seq AAUUAAAUAAAACUCCGAGCCCGCCUUCCUAAGGCAGAUGCUACGGGGGCGUGGCCUGGGGCUUACGACCCCACAGGGUUGUAGGAGAAAUCCUACAGCCUCCCUGUAUGGAAAGGAGGAGAUGCUCAGGCAUG
RS 3 dot …………(((((.((((((((((….(((….)))..))))))).))).)))))((((((((((….))))))))))…..((((((((…..))))).)))…(((……)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table