Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA037359 Similarity: 0.968 Similarity: 0.966 Similarity: 0.966
UTR: 5HSAA037359
Gene: EXPH5
MFE: -24.980
ENS: 0.881
Length: 122.
Predicted Ligands:
TPP - 5/20
cobalamin - 5/20
FMN - 3/20
 RS: URS0000DA3C63_1904969
MFE: -50.848
Ligand: TPP
Species: Saccharomonospora sp. CUA-673 TPP riboswitch (THI element)
 RS: URS0000C817EF_12908
MFE: -20.796
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS000232A49A_1123357
MFE: -47.030
Ligand: cobalamin
Species: Tessaracoccus bendigoensis DSM 12906 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA037359 URS0000DA3C63_1904969 URS0000C817EF_12908 URS000232A49A_1123357
Length 122. 122. 122. 121.
Similarity - 0.968 0.966 0.966
Ensemble Norm 0.881 - - -
MFE -24.980 -50.848 -20.796 -47.030
Ligands - TPP glutamine cobalamin
Gene EXPH5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 12.003 23.007
Length SE - 0. 0. 1.
Lev Distance - 42. 41. 37.
UBS 7. 7. 8. 10.
BS 0. 0. 0. 0.
ILL 1. 2. 0. 2.
ILR 1. 2. 0. 1.
H 4. 4. 5. 4.
BL 1. 1. 3. 4.
BR 1. 0. 3. 3.
UN 0.189 0.197 0.246 0.107

Sequences

Field Description
UTR seq + 25 gaucaaguucgugaaacuggucuuguacagguugaaaaaugccuuccuaacaggaggcgccaaggagcuuaaguguaacucacacacaguaaagaaaATGTCATTAAGTTTCTTAAATGACG
UTR dot + 25 ((((.((((…..))))))))……(((((……(((((((……)))))))……)))))..((((…..))))…………..(((((((((…))))).)))).
RS 1 seq UGGUGUCCGCACGGGAGCCUGGUGGGCUGAGAGGGAGCACCGGCCGCGACGUCCGCGGCCCGACUCCGACCGUGGAACCUGAUCCGGAUCAUGCCGGCGCAGGGAGCGUGAAUCGUAUGCAU
RS 1 dot ….((((((.(((….)))))))))……((((….(((((((…..)))))))…))))……….((((..((((……))))..))))..(((((…..)))))..
RS 2 seq UUCGUUCAUCUUAUAUUUUAUAUAAGACGGAAGUAGGAAACCUGAAAACCUCUUUCUAUUCAGAAAGGCAAGCAAGUACCCGCAAGGGGAACGAGACCGAAAGUUUACCGAAGGAACGCUAU
RS 2 dot ..(.(((.((((((((…)))))))).))).)((((…))))……(((((((….)))))))…….((.(((…..))).))……….((((…….))))…..
RS 3 seq GCGAAGUCUGCCAGACUUGGCAGCGCACGAGGUCGCGAGGAAGCCGGUGGAAAUCCGGCACGGUCCCGCCACUGUUACCCCGUCGGGGGAGUCAGGAACUCGUCUCGUGCGAGUCGUUUCC
RS 3 dot (((….((((((….)))))))))….(((.(((.(((.(((((…….)))))….)))))).)))….((((….))))…..((((..((.(((….))).)).))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table