Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA037408 Similarity: 0.957 Similarity: 0.956 Similarity: 0.956
UTR: 5HSAA037408
Gene: EYA2
MFE: -50.725
ENS: 0.829
Length: 153.
Predicted Ligands:
FMN - 11/20
cobalamin - 7/20
SAM - 1/20
 RS: URS0000DAB4C9_1122188
MFE: -56.359
Ligand: FMN
Species: Lysobacter spongiicola DSM 21749 FMN riboswitch (RFN element)
 RS: URS0000C29E29_1305675
MFE: -46.605
Ligand: FMN
Species: Bacillus solimangrovi FMN riboswitch (RFN element)
 RS: URS000232D93B_1736691
MFE: -54.633
Ligand: cobalamin
Species: Aeromicrobium choanae Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA037408 URS0000DAB4C9_1122188 URS0000C29E29_1305675 URS000232D93B_1736691
Length 153. 152. 152. 153.
Similarity - 0.957 0.956 0.956
Ensemble Norm 0.829 - - -
MFE -50.725 -56.359 -46.605 -54.633
Ligands - FMN FMN cobalamin
Gene EYA2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 19. 5.002 5.001
Length SE - 1. 1. 0.
Lev Distance - 46. 55. 57.
UBS 13. 16. 13. 13.
BS 0. 0. 0. 0.
ILL 4. 3. 3. 4.
ILR 1. 3. 1. 3.
H 4. 4. 4. 4.
BL 4. 6. 6. 4.
BR 6. 5. 6. 5.
UN 0.092 0.092 0.138 0.059

Sequences

Field Description
UTR seq + 25 ggcagcggcaacggcagagacagcaacgugcccgccgcagucagcccggccucgucggacccgcaccggcccgcccgcccgcccgcaccgcgucggggcgcccucuccacugcgcgcgguacaaggaaATGGTAGAACTAGTGATCTCACCCA
UTR dot + 25 (((.(((((…((((…………)))).))))).))).((..(((…(((((…….)))))..))).))((((.((((….((.((((……)))))))))).))))………..((((((.(….).))).)))..
RS 1 seq UAACGUCUUCAGGGCGGGGCGAAACUCCCCACCGGCGGUAGGUCGCGAUGCGACGAGCCCGCGAGCGCCUCCGUGGCCCAGGCCGCGAAGGGUCAGCAGAUCCGGUCCGAUGCCGGAGCCGACGGUCACAGUCCGGAUGAAAGAAGACGGUU
RS 1 dot …((((…..((.((((.(…).)))).))))))..(((.(((..((((…….)))).))))))(((((((((.(((((.((.(((((….)))))..))))..))))).))).))))…….(((..(……)..)))..
RS 2 seq AUCUAUCUUCGGGGCAGGGUGAAAAUCCCGACCGGCGGUGAUGAAGCAGAUUUUUUUGUUUCUUAGUCCGUGACCCGACUACGUUAUCGUAGGCGGUGGACCUGGUGAAACUCCGGGACCGACAGUGAAAGUCUGGAUGGGAGAAGAUGGCG
RS 2 dot (((.(((.((((..(.((((….)))).).)))).))))))((((((((….))))))))…(((((….(((.(((((….))))).))))))))………((((.(..(.(((…….))).)..).))))………
RS 3 seq GAAAUGACGAGGCGCGCGGGUGUUAGAGUGCGCUUCAACAAUCACCUUCCGCAGUGCCAGGGGAAGCCGGUGCGAAUCCGGCGCUGACCCGCAACCGUGAGACCGCCCCUCGGGGCGACGAGCCGGAGCACCUGCCUGUCGGAACCGGCCACA
RS 3 dot ((..((..(((((((((……….)))))))))..)).))..(((((.(…….).)))))(.(((((…((((((.(((.((((…..(((….)))….)))).))..).))))))))))).)…((((….))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table