Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA037412 Similarity: 0.966 Similarity: 0.966 Similarity: 0.965
UTR: 5HSAA037412
Gene: EYA2_0
MFE: -37.140
ENS: 0.878
Length: 133.
Predicted Ligands:
cobalamin - 4/20
molybdenum - 4/20
FMN - 4/20
 RS: URS0000C404AA_1795631
MFE: -48.517
Ligand: zmp-ztp
Species: Variovorax sp. PAMC 28711 ZMP/ZTP riboswitch
 RS: URS0000D92923_192843
MFE: -51.906
Ligand: zmp-ztp
Species: Albidiferax ferrireducens ZMP/ZTP riboswitch
 RS: URS0000BA9A40_1673631
MFE: -31.404
Ligand: cobalamin
Species: Maliponia aquimaris AdoCbl_riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA037412 URS0000C404AA_1795631 URS0000D92923_192843 URS0000BA9A40_1673631
Length 133. 132. 134. 133.
Similarity - 0.966 0.966 0.965
Ensemble Norm 0.878 - - -
MFE -37.140 -48.517 -51.906 -31.404
Ligands - zmp-ztp zmp-ztp cobalamin
Gene EYA2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 14.002 19.002
Length SE - 1. 1. 0.
Lev Distance - 41. 39. 39.
UBS 9. 9. 11. 11.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 5.
ILR 3. 3. 4. 4.
H 3. 5. 3. 3.
BL 1. 1. 4. 2.
BR 2. 0. 2. 4.
UN 0.060 0.076 0.104 0.105

Sequences

Field Description
UTR seq + 25 gcagagcucaacucugccccucaaaccacaauaggaaccagugguuuccgggugauccugaugacaguuuccagugucuaccuggaaugaaacgaaugguacaaggaaATGGTAGAACTAGTGATCTCACCCA
UTR dot + 25 ((((((…..))))))…..(((((((………..)))))))..((((((….(((.((((((((((…((((((……………)))…)))…)))..))))).)).))))))))).
RS 1 seq CGCCGGGCACGCGACUGGCGAUAGGCACACCCCCUCUUGAAGGUAUUUGUGCUGACGUGGAACACCACUGGGAAGCGUGCCGCCUGCGGGAUUUCUUGAGCAGGCGUUCAGCCGUUCGCCUGGGCAGCCCUU
RS 1 dot ((((((……..))))))…((((((…(((…..)))….))))))…((((….)))).((..((((.(((((((((…………)))))))….))))))..)).(((…)))..
RS 2 seq AAACCGGCACGCAACUGGCGAUAGGCACCCUGCCCUGACGGAUUUUUGGGGUGCCGAAGUGGGAACACCACGGGGGAGCGUGCCGCAGGCGCCUAUUCGGGACUUGUGAUCAGCCGUUCGCCUGGGCAGCCCUG
RS 2 dot ….((.((……)).))…(((((((((((…..))…..)))))))))…..(((….((.((((.(((((.((((((((..((…..))..))))))….))))))).))))))…)))..
RS 3 seq UAUCGCUCAAAAAGAGGGGAACACGGAAGCCGGUGAAAGUCCGGCACGGUCGCGCCACUGUGAUCGCGAAAGCGAAAGUCAGACACGAAUCCUCGGAAGAAAACUCAUGACGCGUCAUCACAAGGAGUUCCCA
RS 3 dot ..((.(((…..))).))………(((((…….)))))..((..((.((..((((((((((….((..(((……(((….)))…….)))..)).))))..)))))).)).))..)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table