Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA037578-3 Similarity: 0.973 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA037578-3
Gene: FADS1
MFE: -44.948
ENS: 0.989
Length: 116.
Predicted Ligands:
methionine - 18/20
SAM - 1/20
homocysteine - 1/20
 RS: URS0000ABAB53_710696
MFE: -56.475
Ligand: methionine
Species: Intrasporangium calvum DSM 43043 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000DB21ED_1897634
MFE: -53.806
Ligand: methionine
Species: Tersicoccus sp. Bi-70 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000DB2748_554083
MFE: -57.118
Ligand: methionine
Species: Arthrobacter sp. 1P05MA S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA037578-3 URS0000ABAB53_710696 URS0000DB21ED_1897634 URS0000DB2748_554083
Length 116. 116. 117. 117.
Similarity - 0.973 0.972 0.972
Ensemble Norm 0.989 - - -
MFE -44.948 -56.475 -53.806 -57.118
Ligands - methionine methionine methionine
Gene FADS1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.001 21. 5.003
Length SE - 0. 1. 1.
Lev Distance - 35. 28. 35.
UBS 9. 9. 11. 8.
BS 0. 0. 0. 0.
ILL 3. 2. 1. 1.
ILR 1. 1. 1. 1.
H 4. 4. 4. 4.
BL 2. 2. 5. 2.
BR 3. 1. 5. 3.
UN 0.026 0. 0.017 0.077

Sequences

Field Description
UTR seq + 25 cuccgagccaaacaccgacuaauucggaggaaagcccggaggcgccugaucauaccuguugcccggugauuggguguccugcggaugcgggATGGGAACGCGCGCTGCGAGGCCCG
UTR dot + 25 (((((.((……((((…..))))……)).))))).(((((((((..(((……..))))))))))))((((((….)))))).(((..(.(((…))).).))).
RS 1 seq GGUCAUGAGUGUCAGCGUCACGGCCCCGGCUCGCUGACCGGCAACCCUCGCUACGCGGCGGGGUGCCCCGGGUGAAGACCUGGCACCCGGCAUUCGCCGGCGUGCAAGCGCGAGUG
RS 1 dot ((((((((((….((……))….))))).)))))(((.((((.((((….)))))))))))(((((((………)))))))(((((((..((……)))))))))
RS 2 seq GGUCAUGAGUGUCAGCGACAUGCAGCCCCGGCUCGCUGACCGGCAACCCUCCUACCGCGGUGGGGUGCCCCGGGUGAAGACCUGGCGCCGCGCACUCGCGCGUCGCAAGCGCGGGCC
RS 2 dot ((((((((((….((……..))….))))).)))))((((.(((.((……)).))).))))((((((….)))))).(((.(((.((.(((…))).)).)))))).
RS 3 seq GGUCAUGAGCGUCAGCGCCCUGCAGCCCCGGCUCGCUGACCGGCAACCCUCCAACCGCGGUGGGGUGCCCCGGGUGACGACCUGGCGACGCGCGUCCGCGCGCCGCAAGCGCGGGCC
RS 3 dot ((((((((((….((……..))….))))).)))))((((.(((.((……)).))).))))((((((….))))))……..((((((((…….)))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table