Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA037594 Similarity: 0.960 Similarity: 0.959 Similarity: 0.959
UTR: 5HSAA037594
Gene: FADS1_2
MFE: -43.539
ENS: 0.811
Length: 148.
Predicted Ligands:
cobalamin - 9/20
FMN - 8/20
glucosamine - 3/20
 RS: URS0000C36050_1121126
MFE: -22.908
Ligand: cobalamin
Species: Brochothrix thermosphacta DSM 20171 = FSL F6-1036 AdoCbl riboswitch
 RS: URS00023290F2_876044
MFE: -47.757
Ligand: cobalamin
Species: gamma proteobacterium IMCC3088 Cobalamin riboswitch
 RS: URS0000D7D9F6_1121449
MFE: -52.739
Ligand: FMN
Species: Desulfovibrio gracilis DSM 16080 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA037594 URS0000C36050_1121126 URS00023290F2_876044 URS0000D7D9F6_1121449
Length 148. 148. 146. 148.
Similarity - 0.960 0.959 0.959
Ensemble Norm 0.811 - - -
MFE -43.539 -22.908 -47.757 -52.739
Ligands - cobalamin cobalamin FMN
Gene FADS1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.002 8.030 7.022
Length SE - 0. 4. 0.
Lev Distance - 51. 46. 53.
UBS 9. 8. 10. 10.
BS 0. 0. 0. 1.
ILL 4. 2. 3. 4.
ILR 2. 2. 1. 4.
H 4. 4. 4. 4.
BL 0. 1. 1. 1.
BR 2. 2. 4. 2.
UN 0.257 0.209 0.082 0.108

Sequences

Field Description
UTR seq + 25 acuuacagggcccggggcugccggaccugccaacgugaaucuuaucgccauggaccuuaccuugcacaacccaaagaucccuuuguggccuuccacaucaacaagggccuugugaagaaguauATGGGAACGCGCGCTGCGAGGCCCG
UTR dot + 25 …..((((..((((…..)))).))))(((..((((……))))..)))…………….(((((((….))))).))…………….(((((((((…..(((…((….))…)))))))))))).
RS 1 seq ACACGAUUAUAGUAUUUUAGAAUAAUGGAAGUUUGGUGAAAAUCCAACACGGUCCCGCCACUGUAAUAAGCAAAGAGUGCUUUAAGUCAGGUCUUUUAUCUAAAUUAAACUGGUACUGUUGUUUCGAGGCAAAAACAAUAGUCGCUUA
RS 1 dot …(.(((((………..))))).)…..(((((…..((…..))…)))))(((….(((((…..)))))…..)))…………………(((((((((((((……..)))))))))).)))..
RS 2 seq UACUCUGACCGCGUUCUUGGUGCCUGCCGCCCUCUCGCGGGCUGGGUAGGUUAAAAGGGAAGUCUGGUAAGAAAUCCAGCGCUGCCCCCGCAACGGUAAUCAGCCCCUGCUGUAAGCCCGAUACCUGCCGGAACAGCAACCGAUGG
RS 2 dot …….((((……))))(((((((((((……))))..)))))))…..(((.(((((((……..)))).))).)))(((…((((……….((((((….(((……..))).)))))))))).)))
RS 3 seq ACUUAUUCUCAGGGCGGGGUGGAAUUCCCCACCGGCGGUGAUUCGGCUUUGCCGAAAAGUCCGCGAGCGCUCUUGGUUGUUCAAGAGGUCAGCAGAUCCGGUGUGAUUCCGGAACCGACGGUAACAGUCCGGAUGGAAGAGGAUAAGG
RS 3 dot .(((((((((..((.((((…….)))).)).(((((..((((((…))))))..).))))..(..(((((((….)))))))..)…..((((((..((…(((…….)))…))..))))))….))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table