Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA037614 Similarity: 0.986 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA037614
Gene: FAF1
MFE: -39.642
ENS: 0.926
Length: 88.
Predicted Ligands:
zmp-ztp - 5/20
Ni/Co - 4/20
TPP - 3/20
 RS: URS0000DAEBC6_1834512
MFE: -37.016
Ligand: Mg2+
Species: Frankia sp. BMG5.36 ZMP/ZTP riboswitch
 RS: URS00019FDDE1_2653163
MFE: -30.427
Ligand: glycine
Species: Pseudomonas sp. 8AS Glycine
 RS: URS0000ABAEE2_640081
MFE: -27.614
Ligand: TPP
Species: Dechlorosoma suillum PS TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA037614 URS0000DAEBC6_1834512 URS00019FDDE1_2653163 URS0000ABAEE2_640081
Length 88. 87. 89. 89.
Similarity - 0.986 0.983 0.983
Ensemble Norm 0.926 - - -
MFE -39.642 -37.016 -30.427 -27.614
Ligands - Mg2+ glycine TPP
Gene FAF1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 2.010 1.001
Length SE - 1. 1. 1.
Lev Distance - 17. 21. 22.
UBS 7. 7. 7. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 2. 3. 1. 2.
H 2. 2. 2. 2.
BL 2. 3. 3. 3.
BR 2. 1. 2. 2.
UN 0.080 0.069 0.180 0.112

Sequences

Field Description
UTR seq + 25 aacgccgcugaagguauccgggugcgcgcuucgcucccggagccgcggaacucggcggccgccATGGCGTCCAACATGGACCGGGAGA
UTR dot + 25 ..((((((((..(((.((((((.(((…..))).))))))))).)))….))))).((((((((……..)))))..)))….
RS 1 seq GGGCCGAGUCGUGACUGGCGUGCUGGGGUGGAAUCAACCACCGGGGAGCGACCAAUCGGCACGGCACCGUGCGCCUGGGUGCCGCCG
RS 1 dot ..((((((((((..((.(.(((.(((…….)))..)))).))..)))))…))))).(((((((………)))))))…
RS 2 seq CCGCGCCCCGCAGGAGAGUGGGGGCCCCGGGCCCUCCGCCGAAGGCGCAAACUCCCAUAAUCGCUCAGGCUCAGAACUGCGGAUUCCAU
RS 2 dot ..(((((.((…….(((((((((…))))).))))))..)))))……….((((.(.(((……..))).)))))….
RS 3 seq CUUGGGGGUGCCUGAAAGCCUUGGAAAUACUGGCUUCCGGCUGAGAAAUACCCUUAUGACCUGUACGGGUAAUGCCGUCGUAGGGAAAG
RS 3 dot ..((((((((((.(.(((((..(……).)))))).)))……..)))))))…((((.((((……))))..))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table