Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA037778 Similarity: 0.982 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA037778
Gene: FAM111A
MFE: -17.463
ENS: 0.738
Length: 72.
Predicted Ligands:
cobalamin - 13/20
fluoride - 4/20
purine - 2/20
 RS: URS0000C8358E_1385521
MFE: -27.022
Ligand: cobalamin
Species: Knoellia subterranea KCTC 19937 Cobalamin riboswitch
 RS: URS0000BFB91D_56193
MFE: -22.722
Ligand: fluoride
Species: Sphingobium chungbukense Fluoride riboswitch
 RS: URS0000D68EC4_12908
MFE: -18.011
Ligand: purine
Species: unclassified sequences purine-UUA riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA037778 URS0000C8358E_1385521 URS0000BFB91D_56193 URS0000D68EC4_12908
Length 72. 71. 71. 72.
Similarity - 0.982 0.981 0.981
Ensemble Norm 0.738 - - -
MFE -17.463 -27.022 -22.722 -18.011
Ligands - cobalamin fluoride purine
Gene FAM111A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.005 3. 14.
Length SE - 1. 1. 0.
Lev Distance - 20. 23. 20.
UBS 9. 7. 8. 7.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 1.
ILR 2. 1. 2. 0.
H 2. 2. 1. 2.
BL 3. 2. 4. 4.
BR 2. 1. 2. 1.
UN 0.014 0.085 0.014 0.028

Sequences

Field Description
UTR seq + 25 gugcuggcgaggcgcgcacugaaccauccguucaucuucaagccaucATGAGCTGTAAGAAGCAGAGGTCAC
UTR dot + 25 ((((..((…))..))))((.(((.((.(((..((((..(((((…)).)))..))))))).))))))).
RS 1 seq GGAAAGCCGGUCCAAGUCCGGCGCUGACCCGCAACCGUAGGCCUCCCGUGAGGGCGGCGAGCCGGACCACC
RS 1 dot (((…….)))..(((((((((((.(((.((..((..((…)))))).)))))))..)))))))….
RS 2 seq GGCAUGGACGGCGAUGGAUUUCCGCCUGGCUUCGGCCGAACCGCCUCCGGGCUGAUGAUUCCUACCUGCUG
RS 2 dot ((((.((..((.(((.(…((.((((((…(((…..)))…)))))).))).)))))..)))))).
RS 3 seq GACCUGUAUAUGUCCACUAAUAUGGUGUGGAUGUUUCUACGUGGUUACCGUAAAUUACUACACUAUAGUGUC
RS 3 dot (((……..)))(((((…((((((((.((.((.((((.(….))))))).)))))))))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table