Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA037797 Similarity: 0.972 Similarity: 0.972 Similarity: 0.970
UTR: 5HSAA037797
Gene: FAM114A2
MFE: -44.460
ENS: 0.961
Length: 120.
Predicted Ligands:
methionine - 5/20
SAM - 5/20
TPP - 4/20
 RS: URS0000D845C0_1109743
MFE: -57.176
Ligand: methionine
Species: Streptomyces sp. SCSIO 03032 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000BF175B_1609133
MFE: -55.516
Ligand: methionine
Species: Streptomyces sp. NRRL S-495 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000C28C5E_1262875
MFE: -41.822
Ligand: TPP
Species: Eggerthella sp. CAG:209 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA037797 URS0000D845C0_1109743 URS0000BF175B_1609133 URS0000C28C5E_1262875
Length 120. 120. 118. 121.
Similarity - 0.972 0.972 0.970
Ensemble Norm 0.961 - - -
MFE -44.460 -57.176 -55.516 -41.822
Ligands - methionine methionine TPP
Gene FAM114A2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.001 7. 6.002
Length SE - 0. 4. 1.
Lev Distance - 34. 29. 36.
UBS 10. 9. 9. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 3. 1.
ILR 1. 2. 2. 0.
H 3. 3. 3. 3.
BL 3. 4. 3. 3.
BR 5. 3. 4. 4.
UN 0.058 0.092 0.042 0.107

Sequences

Field Description
UTR seq + 25 ucugcgcugaaggagcacuuccggggcaguaggaacgccgagucggcugccguggcugugcugaggguggcggccggauagcugauguucuaaucATGTCAGATAAAGATGATATTGAGA
UTR dot + 25 .((((.((((((…..)))).)).))))..(((((…..((((((((((((.(((.(….).))).)))))…..))))))))))))..((((((((……..)))))).))..
RS 1 seq GGUCACGAGUGACAGCACGCAUGGACCCCGGUCCGCUGUCCGGCAACCCUCCUUCCGUGGCGGGGUGCUCCCGGGUGAUGACCGGGCCGCGGGCAGCAAGGUCCGCGGCAAGCGCGGAUU
RS 1 dot ((((.((.(((……))).))))))((((((((((….((((.(((.((……)).))).))))….))))..))))))(((((((((……)))))))))………..
RS 2 seq GGUCAUGAGCGACAGCGACAAGCCCCAGCUUGCUGUCCGGCAACCCUCCGUCCGUGGCGGGGUGCCCUGGGUGAGGACCGGGCCGUGCGGCGAGCCGUCCGCGUGGCAAGCGCGGACA
RS 2 dot (((..((.((….))..)).)))…(((((((((.((((…((((..((((.(((…..))).)))).))))…..)))).))))))))).((((((((…..)))))))).
RS 3 seq GAUUCGAUGCAGGGGUGCCUGCGGCGCGUCCAAAUCGCGUUGGCAUGGCUGAGAGGGCAUUCGGCCUAACUCUUUGAACCUGUCAGUUAGUGCUGGCGUAGGGAGCAUCUCAGGUUCAUUC
RS 3 dot (((.((.((((((….)))))).)).)))……((((((((((((((((.(((…(((((………)))))))).))))))).)))))))))…((((…….))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table