Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA037804 Similarity: 0.972 Similarity: 0.967 Similarity: 0.967
UTR: 5HSAA037804
Gene: FAM114A2_0
MFE: -44.089
ENS: 0.904
Length: 121.
Predicted Ligands:
SAM - 8/20
TPP - 5/20
methionine - 2/20
 RS: URS0000C86A6C_1736426
MFE: -50.310
Ligand: zmp-ztp
Species: Leifsonia sp. Root112D2 ZMP/ZTP riboswitch
 RS: URS0000C28C5E_1262875
MFE: -41.822
Ligand: TPP
Species: Eggerthella sp. CAG:209 TPP riboswitch (THI element)
 RS: URS00004ADC78_1288971
MFE: -43.537
Ligand: SAM
Species: [Clostridium] ultunense Esp SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA037804 URS0000C86A6C_1736426 URS0000C28C5E_1262875 URS00004ADC78_1288971
Length 121. 123. 121. 120.
Similarity - 0.972 0.967 0.967
Ensemble Norm 0.904 - - -
MFE -44.089 -50.310 -41.822 -43.537
Ligands - zmp-ztp TPP SAM
Gene FAM114A2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 14.004 8.004
Length SE - 4. 0. 1.
Lev Distance - 30. 37. 40.
UBS 11. 11. 8. 10.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 1. 2. 0. 0.
H 3. 3. 3. 4.
BL 3. 1. 3. 3.
BR 6. 6. 4. 4.
UN 0.041 0.049 0.107 0.108

Sequences

Field Description
UTR seq + 25 cucugcgcugaaggagcacuuccggggcaguaggaacgccgagucggcugccguggcugugcugaggguggcggccggauagcugauguucuaaucATGTCAGATAAAGATGATATTGAGA
UTR dot + 25 ((((((.((((((…..)))).)).)))).))((((…..((((((((((((.(((.(….).))).)))))…..)))))))))))…((((((((……..)))))).))..
RS 1 seq UGGGUCUGUCGCAACUGGCGUAUGGACGGCCCCUCGGGUGCCGCCCCAGGAUGGCUCACCAUCAGGGAGUGACAAGCACCUUCGAGAUGGAGGCGGAUUCGGCCGCGCGCCUGGGCUGGAACG
RS 1 dot …(((((((((…..))).)))))).(((((((((((((((((((..(((((….))))).))).)))….))))))….)).)).))).(.(((((((………))))))).).
RS 2 seq GAUUCGAUGCAGGGGUGCCUGCGGCGCGUCCAAAUCGCGUUGGCAUGGCUGAGAGGGCAUUCGGCCUAACUCUUUGAACCUGUCAGUUAGUGCUGGCGUAGGGAGCAUCUCAGGUUCAUUC
RS 2 dot (((.((.((((((….)))))).)).)))……((((((((((((((((.(((…(((((………)))))))).))))))).)))))))))…((((…….))))….
RS 3 seq CUCUUAUCCAGAGAGGCUGAGGGACUGGCCCAAUGACGCCCGGCAACCGGUUUUAAGCGGAAAGGCUUAAAAACGCGGUGCCAAUUCCUGCAGAGCUUUAAAAGCUCUGAGAGAUAAGAU
RS 3 dot ((((((.((…..)).))))))…(((……..))).(((.(((((((((((((……)))))))).).)))))))…((((.((((((((…)))))))))).))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table