Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA037806 Similarity: 0.959 Similarity: 0.957 Similarity: 0.957
UTR: 5HSAA037806
Gene: FAM114A2_1
MFE: -54.567
ENS: 0.950
Length: 149.
Predicted Ligands:
cobalamin - 6/20
FMN - 6/20
TPP - 5/20
 RS: URS0000AB84C4_380704
MFE: -44.483
Ligand: TPP
Species: Aspergillus niger ATCC 1015 TPP riboswitch (THI element)
 RS: URS0000D7E8E4_1962155
MFE: -72.278
Ligand: cobalamin
Species: Saccharomonospora sp. LRS4.154 AdoCbl riboswitch
 RS: URS0000DA6002_153496
MFE: -63.902
Ligand: TPP
Species: Kozakia baliensis TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA037806 URS0000AB84C4_380704 URS0000D7E8E4_1962155 URS0000DA6002_153496
Length 149. 148. 149. 148.
Similarity - 0.959 0.957 0.957
Ensemble Norm 0.950 - - -
MFE -54.567 -44.483 -72.278 -63.902
Ligands - TPP cobalamin TPP
Gene FAM114A2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.005 22.002 11.
Length SE - 1. 0. 1.
Lev Distance - 46. 47. 52.
UBS 11. 13. 11. 10.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 1.
ILR 1. 2. 4. 2.
H 4. 4. 4. 5.
BL 2. 5. 4. 2.
BR 5. 5. 2. 3.
UN 0.114 0.041 0.067 0.101

Sequences

Field Description
UTR seq + 25 cugcgcugaaggagcacuuccggggcaguaggaacgccgagucggcugccguggcugugcugaggguggcggccggauaggugcggagcuuccugaacgaggcaggagggcugauguucuaaucATGTCAGATAAAGATGATATTGAGA
UTR dot + 25 ((((.((((((…..)))).)).))))……((((…(((((((((…(((.(….).))))))))))))…))))(((..(((((((…….))))))).)))………((((((((……..)))))).))..
RS 1 seq UUGGGCGUGGACCGGUGUUCGUUCCUAUCCGUUGGUUGUGCAGCAUUGCUAGCAUUGCUGCCUGCCAUCGGCUCUGGGUUCGUUCUGAGAUUAUACGGUUAAACUUGAUCUGGAUAAUACCAGCGAAAGGAUCAUGCCUUCCCUCGUU
RS 1 dot .((((..(((((….)))))..)))).(((.((((.(.((((((.((….)).))))))).)))).)))..((((..(.((((..((((((…………)))))))))).)..))))(((..(((……..))).)))..
RS 2 seq GUGCGAUGAUCGGUGCGCGGUCGUCGUGGAACCCGGUGUGAAUCCGGGACGGUCCCGCCACUGUGACCGGCCUCGCGCCGGGAGUCAGAGCUUCGGCGUCCGCCUUGGAACUGCUGGUGACGUGGGCGAGGACACCCACGCUGGCGUUG
RS 2 dot ..((((((((((…..))))))))))….((((((((((..((((.(((((……)))))..))))..))))))))))((.(((..((..(((….)))..))..)))))…(((((.((((.((….)).)))).))))).
RS 3 seq ACGUCCACCAGGGGGUGCCUCGUCAAGAGGCUGAGAUGUCGCUGGCGGAUCGCAAAAUCCGCAGCGCGACGACCCUUCCGACCGCUGCUUGCGGUUGGGGAACCUGAUCCGGUUCGUACCGGCGUAGGGAUUGGUAUGAAGCAGGGAU
RS 3 dot ((.(((….))).))(((((…..)))))…..((((((..((((((……))))))…))))))….((((((((((…..))))))))))……(((((.(((((((((((…..).)))))))))).)..))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table