Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA037853 Similarity: 0.990 Similarity: 0.990 Similarity: 0.990
UTR: 5HSAA037853
Gene: FAM120B
MFE: -9.426
ENS: 0.580
Length: 46.
Predicted Ligands:
unknown - 13/20
preQ_1 - 4/20
SAM - 2/20
 RS: URS0000E600B0_1255619
MFE: -6.770
Ligand: unknown
Species: Vagococcus fluvialis bH819 DUF1646 RNA
 RS: URS0000E5FDCC_1234679
MFE: -8.120
Ligand: unknown
Species: Carnobacterium maltaromaticum LMA28 DUF1646 RNA
 RS: URS0000E5FF68_1234679
MFE: -8.120
Ligand: unknown
Species: Carnobacterium maltaromaticum LMA28 DUF1646 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA037853 URS0000E600B0_1255619 URS0000E5FDCC_1234679 URS0000E5FF68_1234679
Length 46. 46. 46. 46.
Similarity - 0.990 0.990 0.990
Ensemble Norm 0.580 - - -
MFE -9.426 -6.770 -8.120 -8.120
Ligands - unknown unknown unknown
Gene FAM120B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.004 0.004 0.004
Length SE - 0. 0. 0.
Lev Distance - 13. 14. 14.
UBS 2. 2. 2. 2.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.370 0.304 0.304 0.304

Sequences

Field Description
UTR seq + 25 auccuuucccggaguucaguuATGGATCGCCAAATGATCCTTTCCC
UTR dot + 25 .(((……)))……….((((((…..))))))……
RS 1 seq GGUUGGGCGUAAGCUUUCAAGGUGUGUUUUUCUAGGGCGAGAAAAA
RS 1 dot ….((((….))))……….(((((((……)))))))
RS 2 seq GGUUGGGCGCAAGCUUUCAAGGUAAUUUCUUCAGGGGUGAGAAGAA
RS 2 dot ….((((….))))……….((((((……..))))))
RS 3 seq GGUUGGGCGCAAGCUUUCAAGGUGGUUUCUUCAGGGGUGAGAAGAA
RS 3 dot ….((((….))))……….((((((……..))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table