Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA038983 Similarity: 0.976 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA038983
Gene: FAM72A
MFE: -27.680
ENS: 0.850
Length: 95.
Predicted Ligands:
TPP - 11/20
glycine - 3/20
SAM - 2/20
 RS: URS0000AB764C_910954
MFE: -36.601
Ligand: glycine
Species: Dietzia cinnamea P4 Glycine riboswitch
 RS: URS0000ABD550_12908
MFE: -19.492
Ligand: SAM
Species: unclassified sequences SAM-I/IV variant riboswitch
 RS: URS0000C560C9_1509405
MFE: -29.327
Ligand: TPP
Species: Pseudorhizobium pelagicum TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA038983 URS0000AB764C_910954 URS0000ABD550_12908 URS0000C560C9_1509405
Length 95. 97. 93. 95.
Similarity - 0.976 0.975 0.975
Ensemble Norm 0.850 - - -
MFE -27.680 -36.601 -19.492 -29.327
Ligands - glycine SAM TPP
Gene FAM72A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.005 8.008 3.005
Length SE - 4. 4. 0.
Lev Distance - 27. 25. 33.
UBS 9. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 1.
ILR 2. 1. 1. 2.
H 3. 3. 2. 3.
BL 2. 2. 4. 2.
BR 3. 2. 4. 2.
UN 0.137 0.206 0.226 0.063

Sequences

Field Description
UTR seq + 25 cuaggcugggacccgggcuguccgccagggcugggagacacuggaggaggccggccgaugauuacgcgcgATGCCAACGACGACTGCCCTACGGT
UTR dot + 25 …((((((..(((.((.((((..(((….)))..)))))).).))…))))))……….((((…….)).))((((…..))))
RS 1 seq ACGCGUCCCACGGGAGAGCUCCGCGGCCAUGGCCGCGGGCGCCGAAGGAGCAACUCCUCUCCGAGAAUCUCUCAGGCACCCGGACCGUGCGGUCGUC
RS 1 dot ..((.(((..(((….((.(((((((….))))))))).)))..)))))………((((((…)))).))……((((….))))…
RS 2 seq AAGAAGCAUAAAGAGAAGGUUAAGACCUCGGCAACCGUGGAUGACUAUCCAAGGUGCUUGAAGAUGUGGCAGAAAUGCAACUAAGUAGUCAAA
RS 2 dot …((((((…(.((.(((((…((.(((…))).)).))))).)))…))))))……((.(((….))).))…………
RS 3 seq CGAUCUCGACAGGGGCGUCUGCGAUUGCAGGCUGAGAAGGACCCUUUGAACCUGAACCAGAUCAUGCUGGCGGAGGGAGUCGCGACGGCGCAUUC
RS 3 dot …..((((.((((.(((((((….))))))…….).)))))))).(((…((((……))))…)))(((((((….))).))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table