Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA039196 Similarity: 0.990 Similarity: 0.989 Similarity: 0.989
UTR: 5HSAA039196
Gene: FANCA_0
MFE: -21.049
ENS: 0.807
Length: 58.
Predicted Ligands:
glutamine - 13/20
unknown - 7/20

 RS: URS0000C70F78_12908
MFE: -11.866
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C6A7A9_12908
MFE: -8.927
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000E60042_1122156
MFE: -22.042
Ligand: unknown
Species: Lampropedia hyalina DSM 16112 nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA039196 URS0000C70F78_12908 URS0000C6A7A9_12908 URS0000E60042_1122156
Length 58. 59. 57. 57.
Similarity - 0.990 0.989 0.989
Ensemble Norm 0.807 - - -
MFE -21.049 -11.866 -8.927 -22.042
Ligands - glutamine glutamine unknown
Gene FANCA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 4. 7.001
Length SE - 1. 1. 1.
Lev Distance - 11. 12. 12.
UBS 5. 5. 4. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 2.
ILR 1. 2. 2. 0.
H 1. 1. 1. 1.
BL 3. 2. 2. 1.
BR 1. 2. 1. 2.
UN 0.103 0.136 0.105 0.070

Sequences

Field Description
UTR seq + 25 ggagccgccgccggggcuguaggcgccaaggccATGTCCGACTCGTGGGTCCCGAACT
UTR dot + 25 (((.((((…..((((.((.(((……)))))))))…..)))).)))……
RS 1 seq AUCGUUCAAUCUAAGUAUUUCUUAGAUCGGAAGUAGGUCUGUGACUGAAGGAACGCAUG
RS 1 dot .((.((((.((..(((((((((……)))))))…))..)).)))).))…….
RS 2 seq UUCGUUCAUUUUGAUAUUUUUCAAAACGGAAGUAAACGAAAGUUGAAGGAACGCAUG
RS 2 dot (((.(((((((((.(((((((……)))))))..)))))..)))).)))……
RS 3 seq GGGUGUCCGCUGCAUGGUGCGGCAGGGCAGGUUCUUCGCGCUGGUCGGGCCGCCACG
RS 3 dot .((((((((..((..(((((((.(((……)))))))))).))))))).)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table