Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA039203 Similarity: 0.985 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA039203
Gene: FANCA_1
MFE: -26.392
ENS: 0.857
Length: 68.
Predicted Ligands:
fluoride - 10/20
cobalamin - 7/20
glutamine - 1/20
 RS: URS0000D9DFAA_1797846
MFE: -17.869
Ligand: fluoride
Species: Deltaproteobacteria bacterium RBG_16_64_85 Fluoride riboswitch
 RS: URS0000BFE97D_206672
MFE: -12.014
Ligand: fluoride
Species: Bifidobacterium longum NCC2705 Fluoride riboswitch
 RS: URS0000BF1A08_1574623
MFE: -13.967
Ligand: glutamine
Species: Lyngbya confervoides BDU141951 Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA039203 URS0000D9DFAA_1797846 URS0000BFE97D_206672 URS0000BF1A08_1574623
Length 68. 68. 70. 68.
Similarity - 0.985 0.985 0.985
Ensemble Norm 0.857 - - -
MFE -26.392 -17.869 -12.014 -13.967
Ligands - fluoride fluoride glutamine
Gene FANCA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.001 2.009 7.026
Length SE - 0. 4. 0.
Lev Distance - 18. 15. 18.
UBS 6. 5. 5. 5.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 0.
ILR 2. 1. 2. 0.
H 2. 2. 2. 2.
BL 2. 3. 2. 2.
BR 2. 1. 1. 3.
UN 0.147 0.176 0.243 0.309

Sequences

Field Description
UTR seq + 25 ucgggcgcagggagccgccgccggggcuguaggcgccaaggccATGTCCGACTCGTGGGTCCCGAACT
UTR dot + 25 …(((((..(.((((.(….).)))).)..)))))..(((((((…….)))))…))…..
RS 1 seq AACAUAGCGGGCGAUGGAGUUCGCCGAAACCGCCUGUCCGCAAGACGGCUGAUAACUCCUGCGAAGAA
RS 1 dot ……(((((((.(((……)))….))))))).((((.((.(……..))).))))…..
RS 2 seq UGGAGAACCGGCGAUGGAACCCGCCUGAACUCGUUUCGAACCGCACACUGCUGAUAGUUCCUACACACGA
RS 2 dot ..(((..(.((((……..)))).)..)))…..((((.(((…)))…..))))……….
RS 3 seq AUCGUUCAUCCGACCAGCGCAUCUGGACAGGACGGAAGUAAGAGAUAUCUUCUCUGAAGGAACGCGCC
RS 3 dot ….(((.((((.((((…..)))).).))).)))….(((((…..)))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table