Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA039329 Similarity: 0.953 Similarity: 0.952 Similarity: 0.952
UTR: 5HSAA039329
Gene: FANCB
MFE: -44.442
ENS: 0.947
Length: 172.
Predicted Ligands:
cobalamin - 16/20
FMN - 2/20
glycine - 1/20
 RS: URS0002325D08_1797273
MFE: -61.214
Ligand: cobalamin
Species: Candidatus Aminicenantes bacterium RBG_16_63_16 Cobalamin riboswitch
 RS: URS00007CED20_408184
MFE: -67.
Ligand: cobalamin
Species: Mesorhizobium sp. ORS 3359 Cobalamin
 RS: URS000231702C_1801714
MFE: -53.719
Ligand: cobalamin
Species: Nitrospirae bacterium RIFCSPHIGHO2_02_FULL_42_12 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA039329 URS0002325D08_1797273 URS00007CED20_408184 URS000231702C_1801714
Length 172. 173. 170. 174.
Similarity - 0.953 0.952 0.952
Ensemble Norm 0.947 - - -
MFE -44.442 -61.214 -67. -53.719
Ligands - cobalamin cobalamin cobalamin
Gene FANCB - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 25. 6. 4.
Length SE - 1. 4. 4.
Lev Distance - 45. 55. 57.
UBS 13. 13. 13. 14.
BS 0. 0. 0. 0.
ILL 3. 5. 2. 4.
ILR 5. 6. 4. 5.
H 3. 3. 3. 3.
BL 6. 2. 6. 7.
BR 5. 3. 3. 4.
UN 0.087 0.081 0.071 0.069

Sequences

Field Description
UTR seq + 25 agcgcgcuggcgggagguuuggagcagauggauaccguaucgacguggggccuccgguauguugccgcugcguugagguuuagaaacaucaacuggaaucaauuugcauuugaaaauuagaucagcacaaagacuugauauuguggaATGACTAGCAAACAAGCAATGTCAT
UTR dot + 25 ((((((.(((((((((((((.(.(..((((…….))))..).).))))))))…….))))).))))))..(((((((…..((((.((.((…..)).)).))))…)))))))…………(((((((((.(..((…..))..)..))))))))).
RS 1 seq AUGAACUUCAAGGUUUAGAGCGCCGGGAAGUCCGUGGGAAACGGACACAGCCCCCGCUACUGUAACCGGGGACGAAUCCCAGAAGACGCCACUUUCCGAGUCUCAACGGAAAGGAAGGCCUGGGGUGAGAAGGAUCCGGGAGUCAGGAGACCGGCUCUAAACCUGGCCAGCCC
RS 1 dot ……(((..(((((((((((..(((..((((((…..))))))….))).)))).))).))))..)))(..(((((((…..(((.(((((((……..)))))))…))))))))))..)……..(((.(((((((((…..)))…))))))…)))
RS 2 seq GCCGCUGCCUGGUGCCCGCGACGCGGGAGAAUCGGGAACACGGUUUCAUUCCGUGGCGUGCCCAACGCUGUGAGGGGGAUCGCGCCGGCAAAUGCCACUGUCGAUGACGGGAAGGCGCCGGAGCGGGACGAUCCCGAGCCAGAAGACCGGCCCGGCAGACAUGGUUUUCC
RS 2 dot ..(((.((.(((.((.(((..(((((((((((((……))))))..)))))))))).)))))..)).)))…((((((((.(((((….(((.(((((…)))))…)))))))).))…..))))))……((((((((…………)))))))).
RS 3 seq CUUUAUAUGUGAUUUACAGGUAACGGGAAGGGGGUGCGAGUCCCCCACGGUGCCGCCACUGUAAUCGGGGAGUAAGGCUGGAUUAAUGCCACUGGGAUAUGAAUCCUAUCCCGGGAAGGCCCGGCCAAACAAUGAUCCGUAAGUCAGGAAACCUGCCUGUCAGUCAUUCUUACC
RS 3 dot ..((((.(.(((.((((((….(((.(.(((((…….)))))….).)))…))))))))).)..))))((((((……(((.((((((((…….))))))))…)))))))))….((((((..(..((.((((…)))).))..).))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table