Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA039400 Similarity: 0.976 Similarity: 0.975 Similarity: 0.973
UTR: 5HSAA039400
Gene: FANCM
MFE: -41.136
ENS: 0.995
Length: 124.
Predicted Ligands:
SAM - 6/20
TPP - 6/20
molybdenum - 3/20
 RS: URS0000D78653_156994
MFE: -26.970
Ligand: SAM
Species: Reichenbachiella agariperforans SAM riboswitch (S box leader)
 RS: URS0000ABB011_521460
MFE: -38.291
Ligand: SAM
Species: Caldicellulosiruptor bescii DSM 6725 SAM riboswitch (S box leader)
 RS: URS000232E2E2_1797711
MFE: -33.143
Ligand: SAM
Species: Candidatus Curtissbacteria bacterium RIFCSPHIGHO2_01_FULL_41_11 SAM-I/IV variant riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA039400 URS0000D78653_156994 URS0000ABB011_521460 URS000232E2E2_1797711
Length 124. 123. 124. 125.
Similarity - 0.976 0.975 0.973
Ensemble Norm 0.995 - - -
MFE -41.136 -26.970 -38.291 -33.143
Ligands - SAM SAM SAM
Gene FANCM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.001 3.008 14.004
Length SE - 1. 0. 1.
Lev Distance - 27. 33. 30.
UBS 7. 6. 8. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 3.
ILR 2. 2. 1. 4.
H 2. 2. 3. 2.
BL 3. 1. 3. 2.
BR 3. 1. 3. 1.
UN 0.250 0.285 0.161 0.184

Sequences

Field Description
UTR seq + 25 gaguuuugugcgaaggaaaccgauggggaucggaaccguagcgguugagcugcugcugcuacggauaucugacagaagccuucggugguugucggccuaATGAGCGGACGGCAAAGAACGCTTT
UTR dot + 25 ………………(((((.((…(((((.((((((((((………))))))))))…)))))……)).))))).((((((.(((….).)).))))))…………
RS 1 seq CACUUAUCAAGAAAGAUCGAGGGACUGGGCCCGAAGACAUCUUGGCAACAUAUCCAUAGCCGCAAUAUUGGAUGUUGUGCCAACUCCCAUUCUAGAUGCGAAUAUCUGGAUAUAAGAUAGGUA
RS 1 dot ………………..((((…(((.(…(((((((((((…………))))…….)))))))).)))…))))..((((((((….))))))))………….
RS 2 seq UUCUUAUCAAGAGUGGCGGAGGGACUGGCCCAAUGAAGCCCGGCAACCGGAAAAAGGUAGGGGUGCCCUUUUUCUUGGUGCCAAUUCCAGCAGGUAUUUUUUUAAAAUACCUGGCAGAUAAGAA
RS 2 dot (((((…)))))…….((((.((((((((.((((…((((.((…………)).))))…)))))))).)))).))))..((((((((((…))))))))))………..
RS 3 seq ACAGUGCAUCAAGAGUAGUCCAAAGGACUACAGCAACCGAGUCAAAACUUGAUCACGGUGCUGGUUUCCCGGGAGAAACGAUGCGGCUUAUCCAAUCUUGGCAUAAGCAAAAAUAACAAGCCUCU
RS 3 dot …..(((((……..(((…(((…((((.((((.(((((…)))))..))))))))…)))..)))…..))))).(((((((((….))).))))))……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table