Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA039401 Similarity: 0.975 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA039401
Gene: FANCM_0
MFE: -41.136
ENS: 0.999
Length: 118.
Predicted Ligands:
molybdenum - 8/20
methionine - 6/20
TPP - 4/20
 RS: URS0000D9A7D3_2020377
MFE: -47.373
Ligand: methionine
Species: Sinomonas sp. R1AF57 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000C5B84E_1094508
MFE: -34.664
Ligand: TPP
Species: Thermoanaerobacterium saccharolyticum JW/SL-YS485 TPP riboswitch (THI element)
 RS: URS0000C4FD7F_37927
MFE: -49.866
Ligand: methionine
Species: Sinomonas atrocyanea S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA039401 URS0000D9A7D3_2020377 URS0000C5B84E_1094508 URS0000C4FD7F_37927
Length 118. 116. 117. 117.
Similarity - 0.975 0.975 0.975
Ensemble Norm 0.999 - - -
MFE -41.136 -47.373 -34.664 -49.866
Ligands - methionine TPP methionine
Gene FANCM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 2.006 15.003
Length SE - 4. 1. 1.
Lev Distance - 26. 32. 27.
UBS 7. 9. 7. 10.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 2. 2. 3. 2.
H 2. 2. 2. 2.
BL 3. 3. 3. 5.
BR 3. 4. 2. 4.
UN 0.212 0.181 0.137 0.154

Sequences

Field Description
UTR seq + 25 ugugcgaaggaaaccgauggggaucggaaccguagcgguugagcugcugcugcuacggauaucugacagaagccuucggugguugucggccuaATGAGCGGACGGCAAAGAACGCTTT
UTR dot + 25 …………(((((.((…(((((.((((((((((………))))))))))…)))))……)).))))).((((((.(((….).)).))))))…………
RS 1 seq AAUCAAGAGAUCCGGUGGCAAGCCCUGGCUGGCCGGACGGCAACCCUCCUGCUGUAGCGGGGUGCUCCAGGUGAGGAUUCGACGGCGCCGGCAGACCGGCGUCGUAAGUAUGGCGC
RS 1 dot ……..(((((..(((..((((((.((((((.(((.((…)).))).)))..))).))).))))))…..)))))..((((((((((….))))))))))………..
RS 2 seq UAUUUUUGUCUGGGGAGCUGGGGUGAUAGCCCGGCUGAGAGUUAGCAGCUAUUUCUGCUAUGACCCAUAAACCUGAUCUGGAUAAUGCCGGUGUAGGGAGUACAUUGGACUUUAAGU
RS 2 dot …..(((((((((.((.((((((.(((((..(((((……..)))))……))))).)))).))…))..)))))))))..((((((((…..))))))))………
RS 3 seq AAUCAAGAGUUCCGGCAUCAAGCCCUGGCUUGCCGGACGGCAACCCUCCGGCUGUAGUGGGGUGCCCCAGGUGAGGAUUCGACGGCGCGCGGGCCCCCGGCGCCGUAAGUAUGGCGC
RS 3 dot ……(((.(((..((((..(((((.(((.((((((.((…)).))))))…))).))).))….)))).)))))).(((((((.(((….))))))))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table