Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA039402 Similarity: 0.969 Similarity: 0.969 Similarity: 0.969
UTR: 5HSAA039402
Gene: FANK1
MFE: -53.975
ENS: 0.897
Length: 129.
Predicted Ligands:
cobalamin - 7/20
FMN - 6/20
TPP - 5/20
 RS: URS0000AB3AEF_12908
MFE: -28.827
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000C7898E_110500
MFE: -38.072
Ligand: FMN
Species: Pelotomaculum thermopropionicum FMN riboswitch (RFN element)
 RS: URS000231E12C_1797937
MFE: -39.554
Ligand: cobalamin
Species: Elusimicrobia bacterium GWD2_63_28 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA039402 URS0000AB3AEF_12908 URS0000C7898E_110500 URS000231E12C_1797937
Length 129. 131. 130. 129.
Similarity - 0.969 0.969 0.969
Ensemble Norm 0.897 - - -
MFE -53.975 -28.827 -38.072 -39.554
Ligands - cobalamin FMN cobalamin
Gene FANK1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 12.006 11.
Length SE - 4. 1. 0.
Lev Distance - 33. 35. 37.
UBS 10. 11. 10. 10.
BS 0. 0. 0. 0.
ILL 3. 3. 2. 4.
ILR 4. 6. 5. 1.
H 3. 3. 3. 3.
BL 2. 1. 5. 2.
BR 2. 1. 1. 3.
UN 0.062 0.076 0.138 0.062

Sequences

Field Description
UTR seq + 25 cacuucgccuccggguugucagggcaaccguagcgacgccggcccuggcugagaggcguuaggaguccggggguucgcccgcggaggccggggagcagccgaccATGCCACCCTCAAAGCCTCATCCAC
UTR dot + 25 .((((((((((((….((((((((…(((….)))…)))))))))).))))))….)))).((.(((….))).))(((((.(((..(((……..)))..)))…..)))))……
RS 1 seq AUACCGAAAUGCAUGGUGGGAAAUCAGUGUGAAAUUCAUUGGCUGUCCCUGCAACCGUAAAGUCGGAGCGCCACCCGGUAUAGCCCGCUGUUGGACGAUGACCAGGAAAAGUCUAGUUCUGCAAUGCAAAA
RS 1 dot …((((…..(((((((((…((((((((…))))..))))))))….)))))….)))).(((((….)))…))..(((((.((((…(((……..)))..)))).)))..))….
RS 2 seq AGAAACCUUCAGGGACAGGUGAAAUUCCGUACCGGCGGUAUGGCCGAAUGCCGAGCCCGCGAGCCCUUUAAGGGUUGAUCCGGUGAAAAGCCGGGGCCGACAGUAAAAGUCUGGAUGGGAGAAGGUGGUU
RS 2 dot …((((((.((((.(..(((…(((.(((.((((……))))..))).)))..)))..)))))…))))))..((((((…..)))))).(((.(((…….)))..)))…………
RS 3 seq GGAAUUAAAAGCGGCGGCUGUUUUUUUGUAAGAUAGUCAUAUAGCAGAGGAACCCGGUGCGAUCCCGGGGCUGCCCCGCAACGGUAAUGCCGCAAGGCUAGCCCGGUCUACUGCGAACCGUUUAAUCGC
RS 3 dot ((.(((….(((.(((..((((((((((…(((….))).))))))))))))).))))))))(((((…))))).((((((…..(((((((((…..)))))..)))).))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table