Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA039555 Similarity: 0.955 Similarity: 0.955 Similarity: 0.955
UTR: 5HSAA039555
Gene: FASTKD3
MFE: -33.067
ENS: 0.919
Length: 162.
Predicted Ligands:
cobalamin - 7/20
glucosamine - 6/20
FMN - 5/20
 RS: URS0000AB8083_208964
MFE: -66.557
Ligand: FMN
Species: Pseudomonas aeruginosa PAO1 FMN riboswitch (RFN element)
 RS: URS0000AB8B7E_644966
MFE: -86.059
Ligand: glucosamine
Species: Thermaerobacter marianensis DSM 12885 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000C119E4_1886670
MFE: -44.853
Ligand: FMN
Species: Paenibacillus sp. TI45-13ar FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA039555 URS0000AB8083_208964 URS0000AB8B7E_644966 URS0000C119E4_1886670
Length 162. 163. 162. 161.
Similarity - 0.955 0.955 0.955
Ensemble Norm 0.919 - - -
MFE -33.067 -66.557 -86.059 -44.853
Ligands - FMN glucosamine FMN
Gene FASTKD3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.002 15.001 15.002
Length SE - 1. 0. 1.
Lev Distance - 55. 54. 53.
UBS 9. 11. 11. 11.
BS 0. 1. 0. 0.
ILL 2. 3. 3. 4.
ILR 4. 5. 4. 2.
H 2. 3. 3. 3.
BL 1. 2. 4. 2.
BR 3. 3. 3. 4.
UN 0.043 0.086 0.012 0.093

Sequences

Field Description
UTR seq + 25 ggagugauugcccggcagagcgcgauacucguuuguaguuucauaaacauugauguugggucaaucauguucucaauguauuuaaccauguguuuuuaaauuuuuuaauuuaguuaucaaauugagaaucugaugguATGGCATTAATCACCTTGAGGAAGA
UTR dot + 25 …((((((((((((((((((((((…….)))).))))…………))))))).))))))).(((((((.((..(((((((((………..((((((((((…….))))))))))……..)))))..))))..)).)))))))…
RS 1 seq UAACGUUCUCAGGGCGGGGUGAAAGUCCCCACCGGCGGUAAUGGCGCGCAAGGCGCCUAGCCCGCGAGCGCUUGCCGGACCGGCCACCGCCGGACGACAAGGUCAGCAGACCCGGUGCGAUUCCGGGGCCGACGGUCAUAGUCCGGAUAAAGAGAGAACGGGA
RS 1 dot …(((((((..((.((((…….)))).)).((((….(((((…..)))))….))))…..(((.(((((((((((….(((((((((..((((….))))..)).))..))))))))))………))))))…))).)))))))…
RS 2 seq GAAGGCUUGCUAGCGCCAGGACUCGCCGGCAGGGCGCCGGCGAGUUGACGAGGACCGGGCGUAUCGAACCUUCGGCGGAUCGCCCGGCGGUCGGCCACGACCGAGAGCGGCCCGGCAAAUCCCGGGAGCGAUCCCGGGGACAAUACGGGCCAGGUGGCGUGA
RS 2 dot (((((.(((…(((((.((((((((((((…..))))))))))………)).)))))..))).))))).((.((((((…)))))).))((((.(((…..((((((…..((((((((….))))))))……))))))…))))))).
RS 3 seq GUUAUCCUUCGGGGCGGGGCGCAAUUCCCCACCGGCGGUGUUGAGAUCAAGUUUGUAUAGGUCUCUAAGUCCGUGACCCGGCUAUGUGUUGUAUAAUCAUAGACGGUGGAUCUGGUGAGAAUCCGGAGCCGACAGUAUAGUCUGGAUGGGAGAGGGAUACA
RS 3 dot …..((.((((…((((…….)))).)))).))….((((((………..))))))…((((.(..(((((((((((((…………..((((…(((((…….)))))))))))).)))))))…..)))..).))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table