Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA039574 Similarity: 0.980 Similarity: 0.979 Similarity: 0.977
UTR: 5HSAA039574
Gene: FBL
MFE: -36.092
ENS: 0.797
Length: 96.
Predicted Ligands:
TPP - 15/20
homocysteine - 4/20
glycine - 1/20
 RS: URS0000D9D511_211114
MFE: -38.835
Ligand: homocysteine
Species: Kibdelosporangium albatum S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C8A915_1120688
MFE: -31.201
Ligand: TPP
Species: Rhizobium sp. LC145 TPP riboswitch (THI element)
 RS: URS0000C5ECB0_1868282
MFE: -28.985
Ligand: TPP
Species: Chromatiales bacterium (ex Bugula neritina AB1) TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA039574 URS0000D9D511_211114 URS0000C8A915_1120688 URS0000C5ECB0_1868282
Length 96. 96. 96. 96.
Similarity - 0.980 0.979 0.977
Ensemble Norm 0.797 - - -
MFE -36.092 -38.835 -31.201 -28.985
Ligands - homocysteine TPP TPP
Gene FBL - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.007 4.007 7.
Length SE - 0. 0. 0.
Lev Distance - 25. 27. 28.
UBS 7. 6. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 1.
ILR 1. 1. 1. 2.
H 3. 2. 3. 3.
BL 3. 2. 1. 1.
BR 2. 1. 2. 3.
UN 0.146 0.229 0.229 0.146

Sequences

Field Description
UTR seq + 25 cgugcgaaagccccggacucguggaguugugaacgccgcggacuccggagccgcacaaaccagggcucgccATGAAGCCAGGATTCAGTCCCCGTG
UTR dot + 25 .(((((…((.(((((.((((((.(((…))).))))))..))))).)))))))…….((((……..)))).((((…))))…..
RS 1 seq CGGGUCGAGAGGCGCUGCAACGGGCUGCUGGGACCACCACCCCAGCCCGCCACGCUCGACCCGUUUUCCGAUCCGCAACAAGGGCGCCUCCCACUU
RS 1 dot ((((((((…(((.((…(((((((.(((…..)))…))))))).)))))))))))))………………(((…..)))….
RS 2 seq ACCCGCAGACAGGGGCGUCCGGCAAAGCCGGGCUGAGAAGCACCCUUUGAACCUGAACCAGAUCAUGCUGGCGGAGGGAGUCGUCCGGACCAUAUC
RS 2 dot …..(((..(((((((((((((…)))))))……)).)))))))……..((((……))))((((.(….).))))………
RS 3 seq AGUAACUCGCUGGGGUGCGGCCAUUAGCGUCGCUGAGAAACACCCAUUGAACCUGAACCAGGUAAUUCUGGCGUAGGAAGUGAGACAUCGCAACAU
RS 3 dot ……(((.((((((((((((….).)))))……)).)))).))).((((..(((((….)))))..))))..((((….))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table