Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA039725 Similarity: 0.966 Similarity: 0.966 Similarity: 0.966
UTR: 5HSAA039725
Gene: FBXO11
MFE: -14.616
ENS: 0.880
Length: 139.
Predicted Ligands:
cobalamin - 13/20
TPP - 3/20
lysine - 1/20
 RS: URS0002322D78_1909395
MFE: -53.997
Ligand: cobalamin
Species: Nonomuraea sp. ATCC 55076 Cobalamin riboswitch
 RS: URS0002328177_1538463
MFE: -51.189
Ligand: cobalamin
Species: Nocardia donostiensis Cobalamin riboswitch
 RS: URS000231D0A9_1117316
MFE: -21.477
Ligand: cobalamin
Species: Pseudoalteromonas marina DSM 17587 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA039725 URS0002322D78_1909395 URS0002328177_1538463 URS000231D0A9_1117316
Length 139. 138. 138. 139.
Similarity - 0.966 0.966 0.966
Ensemble Norm 0.880 - - -
MFE -14.616 -53.997 -51.189 -21.477
Ligands - cobalamin cobalamin cobalamin
Gene FBXO11 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.004 3. 6.006
Length SE - 1. 1. 0.
Lev Distance - 42. 43. 43.
UBS 10. 10. 10. 10.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 3.
ILR 4. 4. 3. 4.
H 2. 2. 2. 1.
BL 3. 3. 3. 5.
BR 4. 2. 3. 4.
UN 0.115 0.051 0.101 0.194

Sequences

Field Description
UTR seq + 25 aucauagcaauaagauuuguaaaacauugcaauggcugaaaaacugucuaacaggaaauuuuaaguguuauuccaaagaagaacaagccuaaaaaugaugaugugccugcagauATGAACTCCGTCCGAGCCGCCAACC
UTR dot + 25 ……(((((…………..)))))…((((((…..(((((..((((.((((((.((((((.(((….))).))))…)).)))))…….).)))).)))))…..))……))))…….
RS 1 seq AACCGGAUAGAAGGAUACGUUCCGGUAGAUUUCACGGUUGUCCAAGGGAAAUCCGGUGAGAUGCCGGUGCGGACGCGCCACUGUAUCCGGGACCCAGAUCCCGGGAGCCAGGUCGCUUGGCGGCCGUGACCUCGCUGU
RS 1 dot .((((((………….)))))).((..(((((((((.(((((.((..(((((.((..(((((((((((……..))))).))))….))..)))))))…….)).))))))))))))))..))…..
RS 2 seq CCACGUCGUAUGCCGGUAGAGUCCGGUUUUCCGACGUCGGCGGGCGCGGGAAUCCGGUGGGAAUCCGGAACGGUCGCGCCACUGUGACUGUCCUCAUCGCGGACAGAAGUCAGACCUCCCCCGCCGCACAACACUGGA
RS 2 dot ..((((((…(((((……)))))….))))))(((((((.(.(((..((.((……((((((((((((((……))))))))…..)).))))……)).))))).))))))))…………
RS 3 seq UUUUUUUUGCUUUAAAUUAUUUACUUACCCGCCCAUAAUAGAGCUUCAUUUGGAAUGAGGUGUAAGUCCUCAACUGUUCCCGCAACUGUAAUUAGCACUUUGCUUUAAGUCAGAUACAAAUCAAUUUUUAAUGAGCGGG
RS 3 dot ………………………(((((.((((((.((…..((((((..(((((((.((((.((..((.(((…..))).))….)).)))))))))))..))))))…..)).)))….))).)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table