Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA039808 Similarity: 0.979 Similarity: 0.978 Similarity: 0.977
UTR: 5HSAA039808
Gene: FBXO25
MFE: -29.102
ENS: 0.999
Length: 98.
Predicted Ligands:
purine - 11/20
TPP - 7/20
glycine - 2/20
 RS: URS0000AB54A0_314608
MFE: -25.865
Ligand: TPP
Species: Shewanella benthica KT99 TPP riboswitch (THI element)
 RS: URS0000D7E65B_1817768
MFE: -27.
Ligand: glycine
Species: Candidatus Muproteobacteria bacterium RIFCSPLOWO2_01_FULL_60_18 Glycine riboswitch
 RS: URS0000C848C9_1380763
MFE: -20.641
Ligand: purine
Species: Paenibacillus darwinianus Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA039808 URS0000AB54A0_314608 URS0000D7E65B_1817768 URS0000C848C9_1380763
Length 98. 99. 98. 99.
Similarity - 0.979 0.978 0.977
Ensemble Norm 0.999 - - -
MFE -29.102 -25.865 -27. -20.641
Ligands - TPP glycine purine
Gene FBXO25 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 8.002 6.003
Length SE - 1. 0. 1.
Lev Distance - 27. 27. 28.
UBS 7. 8. 6. 6.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 0.
ILR 2. 2. 0. 1.
H 4. 4. 5. 4.
BL 1. 2. 0. 1.
BR 1. 1. 1. 1.
UN 0.163 0.121 0.204 0.222

Sequences

Field Description
UTR seq + 25 ggcccacuuccggcaauaaccgccuggucgccgucaggugaagacugggggccgcaggcgcgcuaggagaacuATGGAGAAATATTCAATAATGAAGA
UTR dot + 25 .(((…….)))……((((((…(((.((((…….)))).)))..))))))(..(((…..)))..)…….((((….))))..
RS 1 seq CGCAUCUUGUCGGAGUGCCUAUUGGCUGAGACCGUUUAUUCGGGAUCCGUUGAACCUGAUCAGGUUAAUACCUGCGAAGGAAACAAGCAUGAUAAUGUC
RS 1 dot .(((.(((….))))))…(((((.((..(((……)))..)).))))).(((…(((((….)))))…)))……((((….)))).
RS 2 seq CCCAGACCCGCGGGAGAGACCCCGAGAAAUAUGGAGAAUCGGGGCGCCGAAGGCGCAAUCGCCAGGAAUCGCUCAGGCAAAAGGACCGUGGAGACGAU
RS 2 dot (((……..)))……(((((………….)))))(((((…)))))….(((..((…..)).)))……..(((….)))..
RS 3 seq UUUCAACAAGCAAAUAGCGAUCGUAUAACCUCACGAAACAGGGUGGGGGUUUCUACGGGAAGCCUUAACUUCCUAACUACGAAUAGCGGAUCAUUCACA
RS 3 dot ………((…..))…((((.((((((((……..)))))).))..))))(((((……)))))…….((((……..))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table