Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA039823 Similarity: 0.991 Similarity: 0.990 Similarity: 0.990
UTR: 5HSAA039823
Gene: FBXO25_0
MFE: -12.508
ENS: 0.987
Length: 63.
Predicted Ligands:
fluoride - 11/20
purine - 6/20
glutamine - 3/20
 RS: URS0000BEAB23_12908
MFE: -10.769
Ligand: fluoride
Species: unclassified sequences Fluoride riboswitch
 RS: URS0002329186_1423
MFE: -16.188
Ligand: purine
Species: Bacillus subtilis Purine riboswitch
 RS: URS0000ABD16B_265311
MFE: -18.846
Ligand: purine
Species: Mesoplasma florum L1 M. florum riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA039823 URS0000BEAB23_12908 URS0002329186_1423 URS0000ABD16B_265311
Length 63. 63. 63. 63.
Similarity - 0.991 0.990 0.990
Ensemble Norm 0.987 - - -
MFE -12.508 -10.769 -16.188 -18.846
Ligands - fluoride purine purine
Gene FBXO25 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.002 3.002 3.004
Length SE - 0. 0. 0.
Lev Distance - 11. 12. 12.
UBS 3. 2. 2. 2.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 1. 0. 0. 0.
BR 1. 0. 0. 0.
UN 0.476 0.524 0.429 0.413

Sequences

Field Description
UTR seq + 25 agguagggacgaugggccgcgggcgcgucaggagaacuATGGAGAAATATTCAATAATGAAGA
UTR dot + 25 ……….((((.(((…))).))))……….((((……))))……….
RS 1 seq CUUUGCACCGGCUAUGGGAUUAGCCUUUAACCGCCCUUCGGAGCUGAUGAUCCCUACAAUUUG
RS 1 dot ………(((((……)))))…………..(((……..)))……….
RS 2 seq ACAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGAUUAUGU
RS 2 dot ……….(((((…….)))))……….((((((…….))))))…….
RS 3 seq ACUUAUACAGGGUAGCAUAAUGGGCUACUGAACCGCCCCGGGACCAAUCUCGGGACUAUAAGU
RS 3 dot ……….((((((…….))))))…….(((((((….)))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table