Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA040094 Similarity: 0.979 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA040094
Gene: FCGRT
MFE: -24.712
ENS: 0.912
Length: 104.
Predicted Ligands:
purine - 17/20
TPP - 2/20
Mg2+ - 1/20
 RS: URS00007A8A34_1473546
MFE: -18.997
Ligand: purine
Species: Lysinibacillus sp. BF-4 Purine riboswitch
 RS: URS0000C45FA7_1476
MFE: -18.858
Ligand: purine
Species: Sporosarcina psychrophila Purine riboswitch
 RS: URS0000C5B52A_1385511
MFE: -18.922
Ligand: purine
Species: Pontibacillus marinus BH030004 = DSM 16465 Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA040094 URS00007A8A34_1473546 URS0000C45FA7_1476 URS0000C5B52A_1385511
Length 104. 102. 102. 102.
Similarity - 0.979 0.978 0.978
Ensemble Norm 0.912 - - -
MFE -24.712 -18.997 -18.858 -18.922
Ligands - purine purine purine
Gene FCGRT - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.037 4.009 1.013
Length SE - 4. 4. 4.
Lev Distance - 21. 24. 25.
UBS 5. 3. 4. 5.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 1. 0. 1. 1.
H 2. 2. 3. 2.
BL 1. 1. 0. 2.
BR 1. 1. 0. 1.
UN 0.298 0.490 0.392 0.412

Sequences

Field Description
UTR seq + 25 agccuaucaagugucuguaauuaauuaaccaacugagauccaguucaggggugaaaguucuucaggucguccucucagcATGGGGGTCCCGCGGCCTCAGCCCT
UTR dot + 25 …………………………(((((…..))))).((((.(((……….(((((((((((……)))))….))))))))).))))
RS 1 seq AUAGUUCUAUUCAAAAAUACUCAUAUAAUCGCGAGGAUAUGGCUCGCAAGUUUCUACCGGCUCACCUUAAAUGAGCUGACUAUGGGUUGUUUCGUUUAGGCA
RS 1 dot …………………………(((((…….)))))………………((((((((((.(((((…))))).))))))))))..
RS 2 seq UGGGAAUAAAAUAGAAGAUAUCGUAUAAAACCGAGGAUAUGGCUCGGAAGUUUCUACCGGGACACCUUAAAUUUCCCGACUACGAUUCAAAUAGAAGGGGGA
RS 2 dot …………………………(((((…….)))))..(((((….)))))……..((((((..(((………)))..))))))
RS 3 seq UAGAAAUUAAAUAAAGGACCUCAUAUAAUCUCGGGAAUAUGGCCCGUAAGUCUCUACCUGACGACCGUUAAUCGUCGGACUAUGAGGGAAGAUCGGUUGCAG
RS 3 dot ………………………….((((…….))))………..(((.((((((….((.(((…..))).))…..)))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table