Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA040128 Similarity: 0.943 Similarity: 0.942 Similarity: 0.941
UTR: 5HSAA040128
Gene: FCHSD2
MFE: -58.899
ENS: 0.985
Length: 191.
Predicted Ligands:
cobalamin - 10/20
lysine - 5/20
FMN - 2/20
 RS: URS0000BEDF87_1262998
MFE: -53.129
Ligand: glucosamine
Species: Firmicutes bacterium CAG:102 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000D944FD_1972458
MFE: -63.017
Ligand: FMN
Species: Candidatus Atribacteria bacterium 4572_76 FMN riboswitch (RFN element)
 RS: URS0000DA21BB_759412
MFE: -60.834
Ligand: lysine
Species: Natranaerobius trueperi Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA040128 URS0000BEDF87_1262998 URS0000D944FD_1972458 URS0000DA21BB_759412
Length 191. 191. 191. 191.
Similarity - 0.943 0.942 0.941
Ensemble Norm 0.985 - - -
MFE -58.899 -53.129 -63.017 -60.834
Ligands - glucosamine FMN lysine
Gene FCHSD2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.001 2.001 7.001
Length SE - 0. 0. 0.
Lev Distance - 70. 78. 76.
UBS 11. 11. 11. 9.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 3.
ILR 3. 6. 4. 3.
H 4. 2. 5. 3.
BL 2. 2. 2. 1.
BR 1. 2. 1. 2.
UN 0.152 0.126 0.183 0.183

Sequences

Field Description
UTR seq + 25 uagucaccgccuccccaccccaagggaaaacaaauuaaggauugacggguccugccucguccccggcugaggggcgaggaggcugucgugcugucuucagaaaagcgaggaccgggcccgggaggugaaaguuacacaagaacugaaaaacauucaaguugagcagATGCAGCCGCCGCCGAGGAAGGTGA
UTR dot + 25 …….((((((((…(((…………….(((((((((((..(((.(((((.((((……))))))))))))))))))….)))))…………….)))…))))))))………….(((((((…..)))).)))……..((….))((((……)))).
RS 1 seq AAGAGUUUUUAAGCGCCAGAGCCGCAGAUUGGGCGGCUGACGAGGCAGGAGUGCAGAGAGCAUUUUAAGUAUUUUUUUGCUUUCCAUAUCGAAAAUUCGGCGGAUGCUCCUCGCCCUUUCGUUCAGGGUCGCAGGCCUUUUUACAAAACAGAGCGGUCAACGCUCCCGACAAAAGAAAGGCAACGAACGAA
RS 1 dot …………(((((.((((….((..(((((((((((((….((((.((((((((…………)))))))).))))…)))…..)))))……….)))))..))))))..)).)))..((((((((……..(((((…..)))))……..))))))))……….
RS 2 seq AUGCUUUUUCGGGGCAGGGUGAGGUUAAUCAAAAAUUAACCAAUUCCCGACCGGUGGUAAAAUUAUCCUCCUUCAGAGAAUGUUGAGAGGAGGUAAUAAGCCCACGAGCUCGGUAUUCGCUAUUGUGAGUACCGAACAGAUCUGGUGAAAAGCCAGAGCCGACAGUAAAGUCUGGAUGGAAGAAGAAGUGA
RS 2 dot …………((..(((…(((((((…..)))))))….)))..)).((((….((((.((((((((((……)))).))))))))))….))))….(((((((((((….)))))))))))…..((((((…..)))))).(((.(((……)))..)))…………
RS 3 seq AGAUGGGGUAGAGGUUGCGAACUGUCAAAAGUACCUAAGAAGAGUUUGGGUAAAACUAAGAUUCUUAGGGAAAGGGAAGUUCGCCGAAGCUUUGAUCUUCUACCCAGAGUUCAAAGUUGGGACUGUACUUAAUAUGUACAGGACUGUCUUCAGGUAGAUUUCCCAUCUAUCUGAGGUGUGCUCUCCAUUUU
RS 3 dot …..((((((((((((((((((.((…….((((((((…(((((……))))).))))))))……)))))))))………))))).))))))………….((..((((((…….))))))..))..((((((((((((…..))))))))))))……………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table