Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA040254 Similarity: 0.986 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA040254
Gene: FDFT1_0
MFE: -17.273
ENS: 0.939
Length: 60.
Predicted Ligands:
fluoride - 16/20
SAM - 1/20
unknown - 1/20
RS: URS0000D6CC7B_441772
MFE: -12.734
Ligand: fluoride
Species: Clostridium botulinum F str. Langeland Fluoride riboswitch
RS: URS0000D696BA_12908
MFE: -19.232
Ligand: SAM
Species: unclassified sequences SAM-VI riboswitch
RS: URS0000D8DA14_52694
MFE: -12.187
Ligand: fluoride
Species: Acetobacterium wieringae Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA040254 URS0000D6CC7B_441772 URS0000D696BA_12908 URS0000D8DA14_52694
Length 60. 60. 60. 60.
Similarity - 0.986 0.985 0.985
Ensemble Norm 0.939 - - -
MFE -17.273 -12.734 -19.232 -12.187
Ligands - fluoride SAM fluoride
Gene FDFT1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.004 0.010 2.034
Length SE - 0. 0. 0.
Lev Distance - 19. 20. 20.
UBS 2. 3. 2. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 1.
H 2. 2. 2. 2.
BL 0. 0. 0. 0.
BR 0. 1. 0. 0.
UN 0.467 0. 0.367 0.283

Sequences

Field Description
UTR seq + 25 aauaccaaacagugauugccgacauuugccggagaATGGCCGCAGCCGCCTGCGGCACCA
UTR dot + 25 ………………(((……..)))……(((((((….)))))))….
RS 1 seq AGAAUUUUGGGCGAUGGAGUUCGUCAUUAAAUGCGUAGAGUUAAUGACUCCUACAAAUAG
RS 1 dot ………(((((……)))))………((((((((…))))).)))……
RS 2 seq CGUAUCAGUGUGCCUCGCAUCCCGCGGGGCGAUAAGUCCUGAAGAAAGGGAUGAUAUGAC
RS 2 dot ……….((((((((…..))))))))….(((((…….)))))……..
RS 3 seq UUCAUAGAAGGUGAUGGAGUUCACCAAAAUUGCUUAUCAGCUGAUGACUCCUGCAGGAUU
RS 3 dot ………(((((……)))))….(((((((((….)))))…..))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table