Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA040291 Similarity: 0.971 Similarity: 0.968 Similarity: 0.968
UTR: 5HSAA040291
Gene: FDPS
MFE: -46.978
ENS: 0.951
Length: 128.
Predicted Ligands:
cobalamin - 6/20
tetrahydrofolate - 3/20
glycine - 3/20
 RS: URS0000DA99A1_1834192
MFE: -29.340
Ligand: tetrahydrofolate
Species: Enterococcus sp. 9D6_DIV0238 THF riboswitch
 RS: URS0000AB2FF3_256318
MFE: -59.966
Ligand: tetrahydrofolate
Species: metagenome sequence THF riboswitch
 RS: URS000232851D_1090471
MFE: -47.834
Ligand: cobalamin
Species: Burkholderia sp. SD3175 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA040291 URS0000DA99A1_1834192 URS0000AB2FF3_256318 URS000232851D_1090471
Length 128. 128. 128. 129.
Similarity - 0.971 0.968 0.968
Ensemble Norm 0.951 - - -
MFE -46.978 -29.340 -59.966 -47.834
Ligands - tetrahydrofolate tetrahydrofolate cobalamin
Gene FDPS - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.007 16.005 16.003
Length SE - 0. 0. 1.
Lev Distance - 37. 37. 36.
UBS 7. 7. 6. 8.
BS 4. 3. 3. 2.
ILL 2. 1. 0. 2.
ILR 1. 3. 0. 2.
H 2. 2. 2. 2.
BL 5. 4. 5. 4.
BR 0. 0. 3. 3.
UN 0.078 0.164 0.148 0.132

Sequences

Field Description
UTR seq + 25 gagccgaucgcggagcggauucugcuuuuaggaguacccgccaacaagcgggaccgagcaggaauccguaucugggaacagagcccuuugcuccucccucagaATGGATTCATCCCTTACCCGCCGGG
UTR dot + 25 …(((…((((((.((((.((((((….(.((.(((((……))))))))))))))((((((((.((((((….((((…..))))….))))))))))))))))))))…))))))).
RS 1 seq AACAGAGUAGGAAAUAAAGCGUCAAGUGCUGAAAGGAUGGGAUGUUGCCUUUCGGACGAAGUAUGAGGUAAAAGAAGCACGAGCUGGCUUUUCUAAUCAUACGCGGUUUUGUUUUCGCAUUCGCUGCA
RS 1 dot ….((((.(((((((((((..(..((.((((((((..(…..)..))))))))))…((((((((.(((((.(((….)))..)))))))..)))))))..)))))))))))..))))……
RS 2 seq GGCAGAGUAAGCUUCCGUGCGUGAAGUGCCGAGUGGACAGGGAGUUGUCACUCGGACGAAGAGACAGGAAGGCGAUGAGUCUGUCAUCGCCAUCCCGUCUCGCGGUACGGAAGCUGCAUCCCGCUGCU
RS 2 dot (((((.(..(((((((((((…..((.((((((.(((((….)))))))))))))…(((((.(((.((((((((…..)))))))).))).)))))…)))))))))))……).)))))
RS 3 seq UUAGAAUGGUAAGCUUGCAGUGAGUGCGAGGAAGCCGGUGGAAACCCGGCACGGUCACGCCACUGUAUGCGGUUCGCAUCGCAAAGAUGAGAGCCGUGAGUCAGACCCCGCUGCAAGCUCUUCUAUUAA
RS 3 dot ….(((((..(((((((((((.(((.((….(((((.(….))))))….)).)))..(((..((((((((.((((…..)))).))))))).)..)))….)))))))))))…)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table