Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA040293 Similarity: 0.946 Similarity: 0.943 Similarity: 0.943
UTR: 5HSAA040293
Gene: FDPS_0
MFE: -67.782
ENS: 0.880
Length: 189.
Predicted Ligands:
cobalamin - 17/20
lysine - 3/20

 RS: URS0000DA50DE_2772432
MFE: -90.555
Ligand: cobalamin
Species: Streptomyces sp. KY70 Cobalamin
 RS: URS0002323F42_1844478
MFE: -90.555
Ligand: cobalamin
Species: Streptomyces sp. IB2014 011-1 Cobalamin riboswitch
 RS: URS0000DAADC4_1736223
MFE: -76.348
Ligand: lysine
Species: Serratia sp. Leaf50 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA040293 URS0000DA50DE_2772432 URS0002323F42_1844478 URS0000DAADC4_1736223
Length 189. 188. 187. 191.
Similarity - 0.946 0.943 0.943
Ensemble Norm 0.880 - - -
MFE -67.782 -90.555 -90.555 -76.348
Ligands - cobalamin cobalamin lysine
Gene FDPS - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 17. 17. 13.002
Length SE - 1. 4. 4.
Lev Distance - 62. 61. 64.
UBS 11. 12. 12. 14.
BS 4. 5. 5. 3.
ILL 1. 4. 4. 2.
ILR 2. 3. 3. 3.
H 4. 3. 3. 3.
BL 6. 4. 4. 6.
BR 8. 8. 8. 8.
UN 0.101 0.117 0.112 0.058

Sequences

Field Description
UTR seq + 25 aggaguacccgccaacaagcgggaccgagcaggaauccguaucugggaacaggugagagaggaugugugcugggccuuggaggaagggggccgagaccgggccuuacuucuguaacgauacugugaggcaucggaaggccagccuguuguguccguuuugaaggATGGATTCATCCCTTACCCGCCGGG
UTR dot + 25 …….(((((……))))).((.((((.(.((((.((((((….))))))…..)))).).)))).))(((.(..(((((((((((….(((((((((((……………))))))).))))..))))…….((.((((((((….)))))))).)).))))).))..).)))
RS 1 seq UGAUAGCUUGCCGGGGCCAGUCGAACCCCAGCGACGGGGUCAGGGAAUCCGGUGCGAGACCGGAACUGACGCGCAGCGGUGAGGGGGACGGGCGGGGCCACGGCCACUGGAGCGCACAUGUGCUCCGGGAAGGCGUCCCGCCCGGACGAACCCGAGUCCGAAGACCUGCUGGCACCCGCGCCCCGCAC
RS 1 dot …..((..((((((((((((.(..(((((.((..(.((((((….((((((…..)))))).))))).).)..)).)).)))(..((((((((((….(((.(((((((((….)))))))))…)))))))))))))..)……..(((….)))).)))))).)))).))…))..
RS 2 seq UGAUAGCUUGCCGGGGCCAGUCGAACCCCAGCGACGGGGUCAGGGAAUCCGGUGCGAGACCGGAACUGACGCGCAGCGGUGAGGGGGACGGGCGGGGCCACGGCCACUGGAGCGCACAUGUGCUCCGGGAAGGCGUCCCGCCCGGACGAACCCGAGUCCGAAGACCUGCUGGCACCCGCGCCCCGCA
RS 2 dot …..((..((((((((((((.(..(((((.((..(.((((((….((((((…..)))))).))))).).)..)).)).)))(..((((((((((….(((.(((((((((….)))))))))…)))))))))))))..)……..(((….)))).)))))).)))).))…)).
RS 3 seq UAAGCCAGAAGAGGCGCGUCGCCCAGGCAAUGUAUCGGAGGAACCGUAUCCUGCGAAGGUGCAUUAUGGGGUGCGACGCCGAGGUCAGACACCCAACGGUUGGGAAAAGAUCGACUACAGGGGCUGAAUCCUCUGGGUUGUCACCGCUAUAGCUCUGUGAGCUAUUGGCAUGGUGGGGCGCUUCUGGGUGU
RS 3 dot …(((…((((((((.(((((((…(((((((((.((((……)))).)))…)))))).)))((((((((.(.((((((((.(.(((…((((((…….))))))…))))))))..)))).).)))).))))((((((((((…))))))).)))…)))).)))))))).)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table